Variant report

Variant	rs111450961
Chromosome Location	chr10:45209874-45209875
allele	-/ATATATATATGTACAGGCAT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 31 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:31 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv2422287	chr10:45044161-45257684	Active TSS Weak transcription Enhancers Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Genic enhancers Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
2	nsv831843	chr10:45084703-45280032	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
3	esv2750893	chr10:45195185-45356594	Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Genic enhancers Bivalent/Poised TSS Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
4	nsv1039167	chr10:45195541-45357798	Weak transcription Flanking Active TSS Enhancers Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Active TSS Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
5	nsv1046534	chr10:45196274-45357798	Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
6	nsv870344	chr10:45201522-45366921	Enhancers Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
7	nsv466885	chr10:45203021-45351530	Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
8	nsv550702	chr10:45203021-45351530	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
9	nsv466886	chr10:45203021-45359483	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
10	nsv550703	chr10:45203021-45359483	Enhancers Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers Active TSS Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
11	esv2750894	chr10:45203117-45352419	Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
12	esv2750895	chr10:45203117-45356563	Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
13	nsv430160	chr10:45203117-45356563	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
14	nsv1035889	chr10:45203117-45357798	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
15	esv2760155	chr10:45203117-45371777	Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Active TSS Weak transcription Bivalent/Poised TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
16	nsv1050711	chr10:45203117-45371777	Weak transcription Enhancers Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
17	nsv1052977	chr10:45203117-45373945	Enhancers Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS Bivalent/Poised TSS Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
18	nsv1051241	chr10:45207779-45357913	Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
19	nsv540576	chr10:45207779-45357913	Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Active TSS Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
20	nsv1044394	chr10:45207779-45361197	Weak transcription Active TSS Enhancers Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
21	nsv540577	chr10:45207779-45361197	Enhancers Active TSS ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
22	nsv430161	chr10:45207994-45352394	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
23	nsv430162	chr10:45208025-45356594	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
24	nsv1054495	chr10:45208025-45357798	Weak transcription Enhancers Flanking Active TSS Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
25	nsv466887	chr10:45208025-45359483	Enhancers Flanking Active TSS Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Active TSS Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
26	nsv550704	chr10:45208025-45359483	Enhancers Flanking Active TSS Weak transcription Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
27	nsv895102	chr10:45208025-45359483	Enhancers Flanking Active TSS Bivalent Enhancer Weak transcription ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
28	nsv895103	chr10:45208025-45368956	Weak transcription Enhancers Flanking Bivalent TSS/Enh Active TSS Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
29	nsv1037692	chr10:45208025-45371777	Enhancers Active TSS Weak transcription Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
30	nsv1052669	chr10:45208025-45373945	Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Active TSS Bivalent/Poised TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
31	nsv550705	chr10:45209441-45359483	Enhancers Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Active TSS Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:9 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr10:45204200-45210000	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
2	chr10:45207000-45212600	Enhancers	Breast Myoepithelial Primary Cells	Breast
3	chr10:45208400-45211200	Enhancers	Fetal Muscle Leg	muscle
4	chr10:45208400-45211400	Enhancers	H1 Derived Mesenchymal Stem Cells	ES cell derived
5	chr10:45208400-45211400	Enhancers	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
6	chr10:45208800-45211600	Enhancers	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
7	chr10:45209400-45211200	Enhancers	Fetal Muscle Trunk	muscle
8	chr10:45209600-45210400	Weak transcription	Muscle Satellite Cultured Cells	--
9	chr10:45209600-45210600	Weak transcription	Colon Smooth Muscle	Colon

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links