Variant report

Variant rs11267274
Chromosome Location chr1:147229628-147229629
allele -/GGGCATTTGCCAGAGGTACATACCA
Outlinks Ensembl   UCSC
Chromatin state (count:37 , 50 per page) page: 1
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:147223200-147229800 Weak transcription Spleen Spleen
2 chr1:147225200-147232200 Weak transcription ES-I3 Cell Line embryonic stem cell
3 chr1:147226400-147230000 Weak transcription Esophagus oesophagus
4 chr1:147228200-147232000 Enhancers HMEC breast
5 chr1:147228400-147230000 Enhancers hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
6 chr1:147228400-147232400 Enhancers Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
7 chr1:147228600-147229800 Enhancers Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
8 chr1:147228600-147229800 Enhancers Gastric stomach
9 chr1:147228600-147229800 Enhancers Left Ventricle heart
10 chr1:147228600-147230000 Enhancers Aorta Aorta
11 chr1:147228600-147230400 Enhancers Foreskin Keratinocyte Primary Cells skin02 Skin
12 chr1:147228600-147230800 Enhancers NHEK skin
13 chr1:147228600-147231000 Enhancers H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
14 chr1:147228600-147231200 Enhancers Foreskin Melanocyte Primary Cells skin03 Skin
15 chr1:147228600-147231400 Enhancers Right Ventricle heart
16 chr1:147228600-147232000 Weak transcription Fetal Brain Male brain
17 chr1:147228600-147232200 Enhancers Placenta Amnion Placenta Amnion
18 chr1:147228600-147232400 Enhancers Foreskin Keratinocyte Primary Cells skin03 Skin
19 chr1:147228600-147235200 Enhancers Right Atrium heart
20 chr1:147228800-147230200 Enhancers HepG2 liver
21 chr1:147228800-147231000 Enhancers Foreskin Melanocyte Primary Cells skin01 Skin
22 chr1:147228800-147232800 Weak transcription Psoas Muscle Psoas
23 chr1:147229000-147230800 Enhancers Fetal Muscle Leg muscle
24 chr1:147229000-147233800 Enhancers Lung lung
25 chr1:147229000-147234000 Weak transcription Primary hematopoietic stem cells blood
26 chr1:147229200-147230200 Enhancers Placenta Placenta
27 chr1:147229200-147230200 Enhancers Hela-S3 cervix
28 chr1:147229200-147233800 Weak transcription Primary hematopoietic stem cells G-CSF-mobilized Female --
29 chr1:147229200-147234200 Weak transcription Primary hematopoietic stem cells G-CSF-mobilized Male --
30 chr1:147229400-147229800 Enhancers Skeletal Muscle Male skeletal muscle
31 chr1:147229400-147230000 Enhancers Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
32 chr1:147229400-147230000 Transcr. at gene 5' and 3' Fetal Lung lung
33 chr1:147229400-147230000 Enhancers Skeletal Muscle Female skeletal muscle
34 chr1:147229600-147229800 Enhancers H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
35 chr1:147229600-147230000 Weak transcription Breast Myoepithelial Primary Cells Breast
36 chr1:147229600-147230000 Transcr. at gene 5' and 3' Fetal Heart heart
37 chr1:147229600-147231200 Weak transcription Adipose Nuclei Adipose

Quick Search:


  
Input of quick search could be:

what's new

Quick links