Variant report

Variant	rs11274494
Chromosome Location	chr3:141372959-141372960
allele	-/CAGGAAGAAGGAGTTGGGAGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 5 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:5 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv949709	chr3:141295050-142178144	Weak transcription Strong transcription Flanking Active TSS Enhancers Genic enhancers Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	61 gene(s)	inside rSNPs	diseases
2	nsv524429	chr3:141372391-141377330	Active TSS Bivalent Enhancer Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
3	esv998781	chr3:141372958-141372978	Enhancers Weak transcription	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
4	esv1569707	chr3:141372958-141372979	Enhancers Weak transcription	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
5	nsv237392	chr3:141372959-141372979	Weak transcription Enhancers	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:9 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr3:141364400-141377600	Weak transcription	Aorta	Aorta
2	chr3:141369600-141373400	Enhancers	Colon Smooth Muscle	Colon
3	chr3:141370600-141373000	Enhancers	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
4	chr3:141370800-141373400	Enhancers	Rectal Smooth Muscle	rectum
5	chr3:141372000-141376000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
6	chr3:141372200-141373000	Enhancers	Fetal Stomach	stomach
7	chr3:141372400-141373000	Enhancers	Primary hematopoietic stem cells G-CSF-mobilized Male	--
8	chr3:141372600-141373200	Enhancers	K562	blood
9	chr3:141372800-141373000	Enhancers	Fetal Heart	heart

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links