Variant report

Variant rs113426308
Chromosome Location chr2:74213062-74213063
allele -/TCCCTGAGCCCCGAGTGATGCGCT
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr2:74211000-74213200 Active TSS Pancreatic Islets Pancreatic Islet
2 chr2:74211200-74213200 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
3 chr2:74211400-74213200 Active TSS Small Intestine intestine
4 chr2:74211800-74213200 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
5 chr2:74212400-74213200 Active TSS Right Atrium heart
6 chr2:74212600-74213200 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
7 chr2:74212600-74213200 Active TSS GM12878-XiMat blood
8 chr2:74212600-74213400 Active TSS Primary T cells from cord blood blood
9 chr2:74212600-74213800 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
10 chr2:74212600-74214000 Flanking Active TSS Primary hematopoietic stem cells blood
11 chr2:74212600-74214400 Active TSS Primary T helper cells PMA-I stimulated --
12 chr2:74212800-74213200 Flanking Active TSS H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
13 chr2:74212800-74213200 Flanking Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
14 chr2:74212800-74213200 Flanking Active TSS H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
15 chr2:74212800-74213200 Flanking Active TSS H9 Derived Neuron Cultured Cells ES cell derived
16 chr2:74212800-74213200 Flanking Active TSS IMR90 fetal lung fibroblasts Cell Line lung
17 chr2:74212800-74213200 Flanking Active TSS Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
18 chr2:74212800-74213200 Flanking Active TSS Primary B cells from peripheral blood blood
19 chr2:74212800-74213200 Flanking Active TSS Primary hematopoietic stem cells short term culture blood
20 chr2:74212800-74213200 Active TSS Primary T helper naive cells from peripheral blood blood
21 chr2:74212800-74213200 Flanking Active TSS Foreskin Fibroblast Primary Cells skin01 Skin
22 chr2:74212800-74213200 Flanking Active TSS Foreskin Keratinocyte Primary Cells skin02 Skin
23 chr2:74212800-74213200 Flanking Active TSS Brain Angular Gyrus brain
24 chr2:74212800-74213200 Flanking Active TSS Brain Anterior Caudate brain
25 chr2:74212800-74213200 Flanking Active TSS Brain Cingulate Gyrus brain
26 chr2:74212800-74213200 Flanking Active TSS Brain Substantia Nigra brain
27 chr2:74212800-74213200 Flanking Active TSS Fetal Intestine Small intestine
28 chr2:74212800-74213200 Flanking Active TSS Fetal Muscle Trunk muscle
29 chr2:74212800-74213200 Flanking Active TSS Fetal Muscle Leg muscle
30 chr2:74212800-74213200 Flanking Active TSS Fetal Stomach stomach
31 chr2:74212800-74213200 Flanking Active TSS Pancreas Pancrea
32 chr2:74212800-74213200 Flanking Active TSS Right Ventricle heart
33 chr2:74212800-74213200 Enhancers Stomach Mucosa stomach
34 chr2:74212800-74213200 Flanking Active TSS Dnd41 blood
35 chr2:74212800-74213200 Flanking Active TSS NH-A brain
36 chr2:74212800-74213200 Active TSS NHDF-Ad bronchial
37 chr2:74212800-74213200 Flanking Active TSS NHEK skin
38 chr2:74212800-74213200 Flanking Active TSS Osteobl bone
39 chr2:74212800-74213400 Flanking Active TSS H1 Cell Line embryonic stem cell
40 chr2:74212800-74213400 Flanking Active TSS Primary neutrophils fromperipheralblood blood
41 chr2:74212800-74213400 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Female --
42 chr2:74212800-74213400 Flanking Active TSS Muscle Satellite Cultured Cells --
43 chr2:74212800-74213400 Flanking Active TSS Cortex derived primary cultured neurospheres brain
44 chr2:74212800-74213400 Flanking Active TSS Foreskin Keratinocyte Primary Cells skin03 Skin
45 chr2:74212800-74213400 Flanking Active TSS Foreskin Melanocyte Primary Cells skin03 Skin
46 chr2:74212800-74213400 Flanking Active TSS Adipose Nuclei Adipose
47 chr2:74212800-74213400 Flanking Active TSS Brain Hippocampus Middle brain
48 chr2:74212800-74213400 Flanking Active TSS Brain Inferior Temporal Lobe brain
49 chr2:74212800-74213400 Flanking Bivalent TSS/Enh Fetal Adrenal Gland Adrenal Gland
50 chr2:74212800-74213400 Flanking Active TSS Fetal Brain Female brain

Quick Search:


  
Input of quick search could be:

what's new

Quick links