Variant report

Variant	rs138950450
Chromosome Location	chr4:1187478-1187479
allele	-/GTGTGGGAAGGATGTGGGGGGTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr4:1172668..1175501-chr4:1185968..1187625,2	MCF-7	breast:
2	chr4:1186052..1187748-chr4:1201395..1203257,2	MCF-7	breast:
3	chr4:1184524..1188288-chr4:1189754..1192117,3	MCF-7	breast:
4	chr4:1184548..1187736-chr4:1238018..1240467,3	MCF-7	breast:
5	chr4:1185381..1187525-chr4:1340358..1342125,2	MCF-7	breast:

Variant related genes	Relation type
ENSG00000163945	Chromatin interaction
ENSG00000159674	Chromatin interaction

Extended variants
information (count: 24 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:24 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv822425	chr4:540105-1413799	Weak transcription Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS Enhancers ZNF genes & repeats Strong transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	108 gene(s)	inside rSNPs	diseases
2	nsv530490	chr4:614355-1399150	Bivalent Enhancer Enhancers Flanking Active TSS Weak transcription Genic enhancers ZNF genes & repeats Strong transcription Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	104 gene(s)	inside rSNPs	diseases
3	nsv1009619	chr4:901897-1215657	Strong transcription Weak transcription ZNF genes & repeats Flanking Active TSS Enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	43 gene(s)	inside rSNPs	diseases
4	nsv1003876	chr4:927509-1191316	Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription Active TSS Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	37 gene(s)	inside rSNPs	diseases
5	nsv1000381	chr4:927509-1198766	Weak transcription Enhancers Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Active TSS Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
6	esv3339080	chr4:970630-1546223	Active TSS Flanking Active TSS Bivalent/Poised TSS Enhancers Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	82 gene(s)	inside rSNPs	diseases
7	nsv829835	chr4:1097586-1304239	Enhancers Genic enhancers Flanking Active TSS Active TSS Bivalent Enhancer Weak transcription ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	59 gene(s)	inside rSNPs	diseases
8	nsv878328	chr4:1141573-1990425	Weak transcription Flanking Active TSS Enhancers Strong transcription Genic enhancers Active TSS Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	121 gene(s)	inside rSNPs	diseases
9	nsv878329	chr4:1147407-1254930	Genic enhancers Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer Weak transcription Active TSS Strong transcription Enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	49 gene(s)	inside rSNPs	diseases
10	nsv878330	chr4:1147407-1523930	Strong transcription Bivalent Enhancer Weak transcription Enhancers Flanking Active TSS Active TSS Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	71 gene(s)	inside rSNPs	diseases
11	nsv593276	chr4:1159680-1227469	Flanking Active TSS Genic enhancers Weak transcription Strong transcription Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Active TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	14 gene(s)	inside rSNPs	diseases
12	nsv461151	chr4:1159680-1236840	Enhancers Flanking Bivalent TSS/Enh Strong transcription Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
13	nsv593277	chr4:1159680-1236840	Flanking Active TSS Weak transcription Flanking Bivalent TSS/Enh Enhancers Strong transcription ZNF genes & repeats Bivalent Enhancer Genic enhancers Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
14	nsv878331	chr4:1159680-1254930	Weak transcription Bivalent Enhancer Enhancers Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Strong transcription Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	49 gene(s)	inside rSNPs	diseases
15	nsv461152	chr4:1159680-1415698	Enhancers Active TSS Flanking Active TSS Strong transcription Bivalent Enhancer Genic enhancers Weak transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	70 gene(s)	inside rSNPs	diseases
16	nsv593278	chr4:1159680-1415698	Enhancers Flanking Bivalent TSS/Enh Genic enhancers Strong transcription Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	70 gene(s)	inside rSNPs	diseases
17	nsv461153	chr4:1174861-1254930	Genic enhancers Weak transcription Flanking Active TSS Enhancers Strong transcription Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	46 gene(s)	inside rSNPs	diseases
18	nsv593279	chr4:1174861-1254930	Weak transcription Flanking Active TSS Strong transcription Enhancers Active TSS Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	46 gene(s)	inside rSNPs	diseases
19	nsv461154	chr4:1179213-1254930	Transcr. at gene 5' and 3' Enhancers Flanking Active TSS Genic enhancers Active TSS Strong transcription Weak transcription ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	46 gene(s)	inside rSNPs	diseases
20	nsv593280	chr4:1179213-1254930	Flanking Active TSS Strong transcription Genic enhancers Active TSS Transcr. at gene 5' and 3' Enhancers Weak transcription ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	46 gene(s)	inside rSNPs	diseases
21	nsv878332	chr4:1179213-1254930	Genic enhancers Weak transcription Enhancers Strong transcription Active TSS Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	46 gene(s)	inside rSNPs	diseases
22	esv3392925	chr4:1186377-1188925	Enhancers Weak transcription Flanking Active TSS Active TSS Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
23	esv3422505	chr4:1186502-1188900	Weak transcription Flanking Active TSS Enhancers Active TSS Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
24	esv3441643	chr4:1187441-1187707	Weak transcription Enhancers Genic enhancers Bivalent Enhancer Flanking Active TSS	Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:74 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:1178400-1189600	Weak transcription	Dnd41	blood
2	chr4:1180800-1194000	Weak transcription	Primary monocytes fromperipheralblood	blood
3	chr4:1181200-1193400	Weak transcription	Primary T helper cells fromperipheralblood	blood
4	chr4:1181200-1193600	Weak transcription	Primary T helper cells PMA-I stimulated	--
5	chr4:1181600-1190000	Weak transcription	Primary T regulatory cells fromperipheralblood	blood
6	chr4:1181600-1190000	Weak transcription	Primary T killer naive cells fromperipheralblood	blood
7	chr4:1181600-1193600	Weak transcription	Primary T killer memory cells from peripheral blood	blood
8	chr4:1182600-1190200	Weak transcription	Primary T helper naive cells from peripheral blood	blood
9	chr4:1184400-1194000	Weak transcription	Primary T cells effector/memory enriched fromperipheralblood	blood
10	chr4:1185000-1204200	Enhancers	Fetal Muscle Leg	muscle
11	chr4:1185200-1188000	Enhancers	Rectal Mucosa Donor 31	rectum
12	chr4:1185200-1188000	Enhancers	Stomach Mucosa	stomach
13	chr4:1185200-1188200	Enhancers	Fetal Muscle Trunk	muscle
14	chr4:1185200-1188400	Enhancers	Ovary	ovary
15	chr4:1185200-1189600	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung
16	chr4:1185200-1190000	Enhancers	Fetal Stomach	stomach
17	chr4:1185200-1190400	Bivalent Enhancer	Placenta	Placenta
18	chr4:1185400-1187800	Enhancers	Duodenum Smooth Muscle	Duodenum
19	chr4:1185400-1187800	Enhancers	Spleen	Spleen
20	chr4:1185400-1188000	Enhancers	Fetal Adrenal Gland	Adrenal Gland
21	chr4:1185400-1188200	Enhancers	Pancreas	Pancrea
22	chr4:1185400-1188200	Enhancers	Right Atrium	heart
23	chr4:1185400-1188400	Enhancers	Liver	Liver
24	chr4:1185400-1188400	Enhancers	Fetal Intestine Small	intestine
25	chr4:1185400-1188400	Enhancers	Left Ventricle	heart
26	chr4:1185400-1188400	Enhancers	Lung	lung
27	chr4:1185400-1188600	Enhancers	Ganglion Eminence derived primary cultured neurospheres	brain
28	chr4:1185400-1188600	Enhancers	Foreskin Melanocyte Primary Cells skin03	Skin
29	chr4:1185400-1188600	Enhancers	Brain Angular Gyrus	brain
30	chr4:1185400-1188600	Enhancers	Rectal Mucosa Donor 29	rectum
31	chr4:1185400-1188600	Enhancers	NH-A	brain
32	chr4:1185400-1188800	Enhancers	Cortex derived primary cultured neurospheres	brain
33	chr4:1185400-1189200	Enhancers	H1 Derived Mesenchymal Stem Cells	ES cell derived
34	chr4:1185400-1189200	Enhancers	Breast Myoepithelial Primary Cells	Breast
35	chr4:1185400-1189200	Enhancers	Brain Cingulate Gyrus	brain
36	chr4:1185400-1190400	Enhancers	Right Ventricle	heart
37	chr4:1185600-1187800	Enhancers	Aorta	Aorta
38	chr4:1185600-1188400	Enhancers	Fetal Intestine Large	intestine
39	chr4:1185600-1189200	Enhancers	Primary Natural Killer cells fromperipheralblood	blood
40	chr4:1185800-1196200	Weak transcription	Small Intestine	intestine
41	chr4:1186400-1188600	Enhancers	NHDF-Ad	bronchial
42	chr4:1186800-1187800	Enhancers	Colon Smooth Muscle	Colon
43	chr4:1186800-1187800	Enhancers	Osteobl	bone
44	chr4:1186800-1188000	Enhancers	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
45	chr4:1186800-1188000	Enhancers	Duodenum Mucosa	Duodenum
46	chr4:1186800-1188600	Enhancers	Fetal Heart	heart
47	chr4:1186800-1189400	Enhancers	Brain Hippocampus Middle	brain
48	chr4:1187000-1187600	Enhancers	Muscle Satellite Cultured Cells	--
49	chr4:1187000-1187800	Enhancers	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
50	chr4:1187000-1187800	Enhancers	Skeletal Muscle Male	skeletal muscle

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links