Variant report

Variant	rs139199025
Chromosome Location	chr3:75722140-75722141
allele	-/CCTTTTCTTCCTGATTGAAGT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr3:75717845-75722186	GM12892	blood:	n/a	n/a
2	POLR2A	chr3:75720831-75722180	SK-N-MC	brain:	n/a	n/a
3	HCFC1	chr3:75720681-75722627	Hela-S3	cervix:	n/a	n/a
4	EGR1	chr3:75721501-75722159	HCT-116	colon:	n/a	n/a
5	EGR1	chr3:75721706-75722172	MCF-7	breast:	n/a	n/a

Variant related genes	Relation type
LINC00960	TF binding region

Extended variants
information (count: 73 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:73 , 50 per page) page: 1 2

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv997253	chr3:75168497-76021627	Bivalent Enhancer ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Weak transcription Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	47 gene(s)	inside rSNPs	diseases
2	esv2422315	chr3:75250088-75853296	Flanking Active TSS Active TSS Weak transcription Strong transcription ZNF genes & repeats Enhancers Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	44 gene(s)	inside rSNPs	diseases
3	nsv428086	chr3:75346159-75914792	Weak transcription Active TSS Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Flanking Active TSS Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	40 gene(s)	inside rSNPs	diseases
4	nsv529016	chr3:75361506-75836858	Weak transcription Active TSS ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Enhancers Strong transcription Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	40 gene(s)	inside rSNPs	diseases
5	nsv432433	chr3:75377715-75774501	Bivalent/Poised TSS Enhancers Active TSS ZNF genes & repeats Weak transcription Strong transcription Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	38 gene(s)	inside rSNPs	diseases
6	esv2756999	chr3:75392078-76003036	Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent/Poised TSS Active TSS Flanking Bivalent TSS/Enh Enhancers Strong transcription Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	41 gene(s)	inside rSNPs	diseases
7	esv2754986	chr3:75392373-75735141	ZNF genes & repeats Flanking Active TSS Strong transcription Active TSS Enhancers Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	36 gene(s)	inside rSNPs	diseases
8	esv2752017	chr3:75392373-75754704	Strong transcription Active TSS Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	36 gene(s)	inside rSNPs	diseases
9	esv2752018	chr3:75393730-75776083	Enhancers Active TSS Bivalent Enhancer Weak transcription ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	37 gene(s)	inside rSNPs	diseases
10	esv2755824	chr3:75394265-75734088	ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Active TSS Genic enhancers Weak transcription Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	35 gene(s)	inside rSNPs	diseases
11	esv2756116	chr3:75394265-75735141	ZNF genes & repeats Enhancers Flanking Active TSS Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Weak transcription Transcr. at gene 5' and 3' Bivalent Enhancer Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	35 gene(s)	inside rSNPs	diseases
12	esv2763755	chr3:75396818-75792056	ZNF genes & repeats Flanking Bivalent TSS/Enh Enhancers Active TSS Bivalent/Poised TSS Weak transcription Strong transcription Flanking Active TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	38 gene(s)	inside rSNPs	diseases
13	nsv1005724	chr3:75396818-75881261	ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Enhancers Bivalent/Poised TSS Weak transcription Active TSS Bivalent Enhancer Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	39 gene(s)	inside rSNPs	diseases
14	nsv998082	chr3:75439781-75823559	ZNF genes & repeats Bivalent Enhancer Weak transcription Strong transcription Active TSS Bivalent/Poised TSS Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	33 gene(s)	inside rSNPs	diseases
15	nsv1014162	chr3:75439781-75892941	Weak transcription Active TSS Bivalent/Poised TSS Enhancers Strong transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	34 gene(s)	inside rSNPs	diseases
16	esv2754995	chr3:75452819-75734088	Active TSS Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Strong transcription Weak transcription ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	27 gene(s)	inside rSNPs	diseases
17	esv2753405	chr3:75452819-75735141	Active TSS Bivalent Enhancer Enhancers Bivalent/Poised TSS Weak transcription Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	27 gene(s)	inside rSNPs	diseases
18	esv2753976	chr3:75452819-75735141	Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Weak transcription Bivalent Enhancer Flanking Active TSS Strong transcription Enhancers ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	27 gene(s)	inside rSNPs	diseases
19	esv1808663	chr3:75466176-75902476	Weak transcription Bivalent Enhancer Enhancers Bivalent/Poised TSS ZNF genes & repeats Flanking Active TSS Active TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	30 gene(s)	inside rSNPs	diseases
20	nsv915897	chr3:75471836-75793433	Bivalent Enhancer ZNF genes & repeats Weak transcription Enhancers Bivalent/Poised TSS Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	27 gene(s)	inside rSNPs	diseases
21	nsv590701	chr3:75481114-75912373	Weak transcription Flanking Active TSS Enhancers Strong transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	28 gene(s)	inside rSNPs	diseases
22	nsv1011839	chr3:75507382-75733782	Active TSS Flanking Active TSS Bivalent Enhancer Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	18 gene(s)	inside rSNPs	diseases
23	nsv1012775	chr3:75507382-75776083	Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Enhancers Active TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA	20 gene(s)	inside rSNPs	diseases
24	nsv1008502	chr3:75507382-75787726	Bivalent/Poised TSS Bivalent Enhancer Active TSS Weak transcription ZNF genes & repeats Enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
25	nsv1009064	chr3:75507382-75792044	Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Enhancers Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
26	nsv999192	chr3:75507382-75806366	Bivalent/Poised TSS ZNF genes & repeats Active TSS Bivalent Enhancer Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
27	nsv999953	chr3:75507382-75881261	Weak transcription ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Strong transcription Bivalent/Poised TSS Enhancers Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	22 gene(s)	inside rSNPs	diseases
28	nsv999731	chr3:75507382-75894520	Active TSS Weak transcription Enhancers Flanking Active TSS Strong transcription ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	22 gene(s)	inside rSNPs	diseases
29	nsv1012001	chr3:75508542-75826174	ZNF genes & repeats Strong transcription Flanking Active TSS Enhancers Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
30	nsv432456	chr3:75514110-75796710	Enhancers ZNF genes & repeats Weak transcription Bivalent Enhancer Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
31	nsv1001674	chr3:75514396-75781697	Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Weak transcription Enhancers Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	20 gene(s)	inside rSNPs	diseases
32	nsv1013154	chr3:75514396-75806366	Weak transcription ZNF genes & repeats Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Flanking Active TSS Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
33	nsv1001801	chr3:75527170-75792044	ZNF genes & repeats Active TSS Bivalent/Poised TSS Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Weak transcription Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
34	nsv999261	chr3:75538843-75741165	ZNF genes & repeats Active TSS Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	18 gene(s)	inside rSNPs	diseases
35	nsv1011756	chr3:75538843-75781697	Flanking Bivalent TSS/Enh Weak transcription ZNF genes & repeats Bivalent Enhancer Active TSS Enhancers Bivalent/Poised TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA	20 gene(s)	inside rSNPs	diseases
36	nsv1002847	chr3:75538843-75792044	Active TSS Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Weak transcription Enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
37	esv1792564	chr3:75545172-75796728	Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Enhancers Bivalent/Poised TSS Bivalent Enhancer Weak transcription Flanking Active TSS Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
38	esv1828594	chr3:75545172-75796728	ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Genic enhancers Weak transcription Flanking Active TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
39	esv1840403	chr3:75545172-75796728	Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent/Poised TSS Active TSS Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
40	esv2754992	chr3:75545172-75913502	Weak transcription Flanking Active TSS ZNF genes & repeats Enhancers Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	22 gene(s)	inside rSNPs	diseases
41	nsv1010147	chr3:75546718-75788105	ZNF genes & repeats Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Weak transcription Bivalent Enhancer Flanking Active TSS Enhancers Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	20 gene(s)	inside rSNPs	diseases
42	nsv834737	chr3:75558251-75761573	Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Active TSS Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA	17 gene(s)	inside rSNPs	diseases
43	esv17725	chr3:75567240-75817199	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Bivalent Enhancer Active TSS Bivalent/Poised TSS Enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	20 gene(s)	inside rSNPs	diseases
44	esv1831988	chr3:75568433-75803471	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Enhancers Flanking Active TSS Bivalent Enhancer Active TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	20 gene(s)	inside rSNPs	diseases
45	nsv590711	chr3:75568433-75918869	Flanking Active TSS Bivalent/Poised TSS Weak transcription Active TSS ZNF genes & repeats Strong transcription Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	21 gene(s)	inside rSNPs	diseases
46	nsv534366	chr3:75571154-75793273	Active TSS Bivalent/Poised TSS Flanking Active TSS Weak transcription Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	19 gene(s)	inside rSNPs	diseases
47	nsv876983	chr3:75572199-76024339	Bivalent Enhancer Enhancers ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	22 gene(s)	inside rSNPs	diseases
48	nsv876984	chr3:75589320-75786440	ZNF genes & repeats Weak transcription Flanking Active TSS Active TSS Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA	19 gene(s)	inside rSNPs	diseases
49	esv1824644	chr3:75604469-75794567	Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Enhancers Weak transcription Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA	17 gene(s)	inside rSNPs	diseases
50	nsv428418	chr3:75615943-75973574	Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Enhancers Active TSS Bivalent Enhancer Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	19 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:48 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr3:75716600-75722400	ZNF genes & repeats	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
2	chr3:75716800-75722400	Bivalent/Poised TSS	HUES64 Cell Line	embryonic stem cell
3	chr3:75717000-75722600	ZNF genes & repeats	IMR90 fetal lung fibroblasts Cell Line	lung
4	chr3:75717200-75722400	Bivalent/Poised TSS	iPS-20b Cell Line	embryonic stem cell
5	chr3:75717400-75722600	Bivalent/Poised TSS	HUES48 Cell Line	embryonic stem cell
6	chr3:75718600-75722400	Flanking Bivalent TSS/Enh	Primary hematopoietic stem cells G-CSF-mobilized Male	--
7	chr3:75719000-75722600	Bivalent/Poised TSS	HUES6 Cell Line	embryonic stem cell
8	chr3:75719200-75722400	Active TSS	Foreskin Fibroblast Primary Cells skin02	Skin
9	chr3:75719200-75722600	Bivalent/Poised TSS	iPS-15b Cell Line	embryonic stem cell
10	chr3:75719600-75722400	Bivalent/Poised TSS	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
11	chr3:75719800-75722600	Bivalent/Poised TSS	iPS-18 Cell Line	embryonic stem cell
12	chr3:75720000-75722400	Bivalent/Poised TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
13	chr3:75720000-75722600	Active TSS	NHDF-Ad	bronchial
14	chr3:75720200-75722400	ZNF genes & repeats	Placenta Amnion	Placenta Amnion
15	chr3:75720400-75722200	Bivalent/Poised TSS	Fetal Kidney	kidney
16	chr3:75720400-75722600	Active TSS	Foreskin Keratinocyte Primary Cells skin02	Skin
17	chr3:75720400-75722600	Active TSS	NH-A	brain
18	chr3:75720600-75722400	Bivalent/Poised TSS	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
19	chr3:75720800-75722400	ZNF genes & repeats	ES-UCSF4 Cell Line	embryonic stem cell
20	chr3:75720800-75722600	Active TSS	Muscle Satellite Cultured Cells	--
21	chr3:75721000-75722200	Bivalent/Poised TSS	H1 Cell Line	embryonic stem cell
22	chr3:75721000-75722400	Bivalent/Poised TSS	Fetal Lung	lung
23	chr3:75721000-75722600	Bivalent/Poised TSS	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
24	chr3:75721400-75722400	Active TSS	ES-WA7 Cell Line	embryonic stem cell
25	chr3:75721400-75722400	Bivalent/Poised TSS	Fetal Intestine Large	intestine
26	chr3:75721600-75722200	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
27	chr3:75721600-75722200	Active TSS	Primary hematopoietic stem cells short term culture	blood
28	chr3:75721600-75722200	Flanking Active TSS	Primary hematopoietic stem cells G-CSF-mobilized Female	--
29	chr3:75721600-75722400	Bivalent/Poised TSS	H9 Derived Neuron Cultured Cells	ES cell derived
30	chr3:75721600-75722400	Active TSS	Hela-S3	cervix
31	chr3:75721800-75722400	Active TSS	Adipose Nuclei	Adipose
32	chr3:75721800-75722600	Active TSS	ES-I3 Cell Line	embryonic stem cell
33	chr3:75721800-75722600	Active TSS	Breast Myoepithelial Primary Cells	Breast
34	chr3:75721800-75722600	Active TSS	Dnd41	blood
35	chr3:75721800-75722600	Active TSS	NHEK	skin
36	chr3:75721800-75723600	Weak transcription	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
37	chr3:75722000-75722400	Bivalent/Poised TSS	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
38	chr3:75722000-75722400	Active TSS	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
39	chr3:75722000-75722400	Bivalent/Poised TSS	Foreskin Keratinocyte Primary Cells skin03	Skin
40	chr3:75722000-75722400	Bivalent/Poised TSS	Fetal Stomach	stomach
41	chr3:75722000-75722600	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
42	chr3:75722000-75722600	Active TSS	NHLF	lung
43	chr3:75722000-75723400	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
44	chr3:75722000-75723400	Weak transcription	Esophagus	oesophagus
45	chr3:75722000-75723600	Weak transcription	H1 Derived Mesenchymal Stem Cells	ES cell derived
46	chr3:75722000-75723600	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
47	chr3:75722000-75723600	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
48	chr3:75722000-75723600	Weak transcription	Pancreas	Pancrea

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links