Variant report

Variant	rs139452942
Chromosome Location	chr4:93553794-93553795
allele	-/AAGAAAGGAAAGGAAGGGAAGAAGTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 13 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:13 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv948712	chr4:93007985-93740409	Weak transcription Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription ZNF genes & repeats Flanking Active TSS Active TSS Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
2	nsv1005500	chr4:93359923-93590452	Weak transcription Enhancers Active TSS Strong transcription Flanking Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	Chromatin interactive region lncRNA	n/a	inside rSNPs	diseases
3	nsv537184	chr4:93359923-93590452	Enhancers Weak transcription Flanking Active TSS Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Strong transcription	Chromatin interactive region lncRNA	n/a	inside rSNPs	diseases
4	nsv879605	chr4:93376231-93740409	Enhancers Weak transcription ZNF genes & repeats Genic enhancers Active TSS Strong transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
5	nsv1014431	chr4:93464326-93618241	Weak transcription Enhancers Active TSS Strong transcription ZNF genes & repeats Genic enhancers Flanking Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
6	nsv537185	chr4:93464326-93618241	Weak transcription Enhancers Strong transcription Active TSS Flanking Active TSS ZNF genes & repeats Genic enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases
7	nsv879608	chr4:93480717-93612903	Enhancers Active TSS Weak transcription ZNF genes & repeats Strong transcription Genic enhancers Flanking Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
8	nsv879609	chr4:93489287-93596167	Active TSS Enhancers Weak transcription ZNF genes & repeats Strong transcription Genic enhancers Flanking Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
9	nsv830008	chr4:93510957-93685935	Enhancers Weak transcription Strong transcription Active TSS Flanking Active TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
10	nsv879610	chr4:93542768-93646501	Enhancers Weak transcription Strong transcription Active TSS ZNF genes & repeats Flanking Active TSS	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
11	nsv869890	chr4:93551923-93599587	Weak transcription Enhancers Flanking Active TSS Active TSS Strong transcription	Chromatin interactive region	n/a	inside rSNPs	diseases
12	nsv999973	chr4:93553282-93622621	Weak transcription Enhancers Active TSS Flanking Active TSS Strong transcription	TF binding region Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
13	esv2763843	chr4:93553294-93728747	Active TSS Enhancers Weak transcription Strong transcription ZNF genes & repeats Flanking Active TSS	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:9 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:93547000-93555200	Weak transcription	ES-WA7 Cell Line	embryonic stem cell
2	chr4:93550000-93574800	Weak transcription	H1 Cell Line	embryonic stem cell
3	chr4:93551800-93553800	Weak transcription	ES-I3 Cell Line	embryonic stem cell
4	chr4:93551800-93554400	Weak transcription	iPS-18 Cell Line	embryonic stem cell
5	chr4:93551800-93556200	Weak transcription	HUES6 Cell Line	embryonic stem cell
6	chr4:93552000-93579000	Weak transcription	HUES64 Cell Line	embryonic stem cell
7	chr4:93553400-93553800	Weak transcription	Fetal Brain Male	brain
8	chr4:93553600-93553800	Enhancers	HUES48 Cell Line	embryonic stem cell
9	chr4:93553600-93554000	Weak transcription	iPS-20b Cell Line	embryonic stem cell

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links