Variant report

Variant	rs143070962
Chromosome Location	chr1:92534810-92534811
allele	-/ATGTGACATCTTCACATAGTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr1:92532650..92534894-chr1:92538818..92540475,2	K562	blood:

Extended variants
information (count: 32 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:32 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1012864	chr1:92067100-92827761	Flanking Active TSS Strong transcription Enhancers Active TSS Weak transcription Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	33 gene(s)	inside rSNPs	diseases
2	nsv535029	chr1:92067100-92827761	Strong transcription Weak transcription Enhancers Active TSS Genic enhancers Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	33 gene(s)	inside rSNPs	diseases
3	nsv530438	chr1:92091957-92827760	Weak transcription Active TSS Strong transcription Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	33 gene(s)	inside rSNPs	diseases
4	nsv1010179	chr1:92140209-92655952	Weak transcription Genic enhancers Flanking Active TSS Enhancers Strong transcription Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	19 gene(s)	inside rSNPs	diseases
5	nsv535030	chr1:92140209-92655952	Enhancers Weak transcription Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS Strong transcription ZNF genes & repeats Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	19 gene(s)	inside rSNPs	diseases
6	nsv949449	chr1:92211020-92585831	Strong transcription Enhancers Genic enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
7	nsv524845	chr1:92215725-92598705	Enhancers Weak transcription Flanking Active TSS Active TSS Strong transcription Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
8	nsv462517	chr1:92215725-92598705	Weak transcription Bivalent Enhancer Enhancers Active TSS Genic enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
9	nsv546810	chr1:92215725-92598705	Flanking Active TSS Enhancers Weak transcription Active TSS Genic enhancers Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
10	nsv1006318	chr1:92216408-92608324	Flanking Active TSS Enhancers Active TSS Transcr. at gene 5' and 3' Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Strong transcription ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
11	nsv432498	chr1:92218245-92618323	Weak transcription Strong transcription Genic enhancers Flanking Active TSS Enhancers Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
12	nsv1004570	chr1:92220544-92622129	Weak transcription Enhancers Active TSS Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
13	nsv1007661	chr1:92220544-92655952	Weak transcription Enhancers Active TSS Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	19 gene(s)	inside rSNPs	diseases
14	nsv1014837	chr1:92233905-92618839	Enhancers Active TSS Weak transcription Flanking Active TSS Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
15	nsv535031	chr1:92233905-92618839	Bivalent/Poised TSS Enhancers Weak transcription Bivalent Enhancer Genic enhancers Strong transcription Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
16	nsv1012134	chr1:92235485-92598800	Weak transcription Genic enhancers Flanking Active TSS Active TSS Enhancers Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
17	nsv546818	chr1:92236048-92579206	Enhancers Flanking Active TSS Weak transcription Bivalent Enhancer Active TSS Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
18	nsv546819	chr1:92256626-92558583	Strong transcription Enhancers Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
19	nsv546820	chr1:92273644-92558583	Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS Active TSS Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
20	nsv530046	chr1:92277460-92799794	Enhancers Flanking Active TSS ZNF genes & repeats Strong transcription Weak transcription Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	32 gene(s)	inside rSNPs	diseases
21	nsv1007270	chr1:92289298-92598800	Active TSS Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Strong transcription Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
22	nsv1002730	chr1:92302541-92565229	Active TSS Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
23	nsv871415	chr1:92340684-92641607	Weak transcription Active TSS Flanking Active TSS Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
24	esv2750842	chr1:92356781-92579675	Flanking Active TSS Enhancers Active TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
25	nsv871144	chr1:92380302-92641607	Enhancers Strong transcription Active TSS Weak transcription ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
26	nsv1008863	chr1:92441031-92567045	Weak transcription Strong transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Active TSS Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region	8 gene(s)	inside rSNPs	diseases
27	nsv535032	chr1:92441031-92567045	ZNF genes & repeats Enhancers Active TSS Strong transcription Flanking Active TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region	8 gene(s)	inside rSNPs	diseases
28	nsv871606	chr1:92444125-92538104	Active TSS Enhancers Flanking Active TSS Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	6 gene(s)	inside rSNPs	diseases
29	nsv871508	chr1:92478130-92781579	Weak transcription Enhancers Flanking Active TSS Strong transcription Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
30	nsv1009079	chr1:92525630-92595669	Enhancers Strong transcription Weak transcription Active TSS ZNF genes & repeats Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region	6 gene(s)	inside rSNPs	diseases
31	nsv546821	chr1:92525678-92650349	ZNF genes & repeats Enhancers Strong transcription Active TSS Weak transcription Genic enhancers Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
32	nsv947288	chr1:92533478-92545371	Active TSS Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region	4 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:3 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr1:92516800-92536200	Weak transcription	ES-I3 Cell Line	embryonic stem cell
2	chr1:92534600-92535200	Enhancers	A549	lung
3	chr1:92534800-92535200	Enhancers	K562	blood

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links