Variant report

Variant	rs144428110
Chromosome Location	chr5:79901500-79901501
allele	-/AGATAGAAAGTCATCTCCATCAG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 2 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:2 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1024844	chr5:79862428-80860430	Weak transcription Strong transcription Enhancers Bivalent Enhancer Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	42 gene(s)	inside rSNPs	diseases
2	nsv513244	chr5:79900666-79904808	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats	TF binding region Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:79899400-79910200	Weak transcription	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links