Variant report

Variant rs144506622
Chromosome Location chr12:9556853-9556854
allele -/CCCCCCATCGCACGGGGGGGAGGGA
Outlinks Ensembl   UCSC
Chromatin state (count:23 , 50 per page) page: 1
No. Chromosome Location Chromatin state Cell line Tissue
1 chr12:9541400-9557200 Weak transcription Primary hematopoietic stem cells G-CSF-mobilized Male --
2 chr12:9541800-9557400 Weak transcription Primary hematopoietic stem cells G-CSF-mobilized Female --
3 chr12:9544800-9593200 Weak transcription H9 Cell Line embryonic stem cell
4 chr12:9545400-9573800 Weak transcription Fetal Intestine Small intestine
5 chr12:9545400-9575600 Weak transcription H9 Derived Neuron Cultured Cells ES cell derived
6 chr12:9546200-9559400 Weak transcription A549 lung
7 chr12:9547000-9558600 Weak transcription Cortex derived primary cultured neurospheres brain
8 chr12:9547400-9557400 Weak transcription Primary mononuclear cells fromperipheralblood Blood
9 chr12:9549400-9558800 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
10 chr12:9549400-9559200 Weak transcription Primary T helper naive cells fromperipheralblood blood
11 chr12:9549400-9564000 Weak transcription H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
12 chr12:9551400-9557000 Weak transcription Dnd41 blood
13 chr12:9555200-9557600 Transcr. at gene 5' and 3' Foreskin Melanocyte Primary Cells skin01 Skin
14 chr12:9555600-9559400 Weak transcription Colonic Mucosa Colon
15 chr12:9555800-9557400 Genic enhancers iPS DF 19.11 Cell Line embryonic stem cell
16 chr12:9555800-9557400 Weak transcription Fetal Muscle Trunk muscle
17 chr12:9555800-9557800 Transcr. at gene 5' and 3' Foreskin Melanocyte Primary Cells skin03 Skin
18 chr12:9555800-9558400 Weak transcription Ganglion Eminence derived primary cultured neurospheres brain
19 chr12:9556200-9558400 Weak transcription Breast Myoepithelial Primary Cells Breast
20 chr12:9556400-9557400 Enhancers ES-UCSF4 Cell Line embryonic stem cell
21 chr12:9556600-9557200 ZNF genes & repeats Fetal Thymus thymus
22 chr12:9556600-9557800 ZNF genes & repeats Foreskin Keratinocyte Primary Cells skin02 Skin
23 chr12:9556800-9557400 ZNF genes & repeats Fetal Stomach stomach

Quick Search:


  
Input of quick search could be:

what's new

Quick links