Variant report

Variant	rs145017745
Chromosome Location	chr15:34330811-34330812
allele	-/CGCCACCAGGCGCGCCCCCG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

TF binding
region (count:0)
CpG islands
(count:0)
Chromatin interactive
region (count:13)
LncRNA
region (count:0)
Mature miRNA
region (count: 0)
miRNA target
sites (count:0)

No data

(count:13 , 50 per page) page: 1

No.	Distal block	Cell Line	Cell type
1	chr1:45987162..45987999-chr15:34330632..34331222,2	NB4	blood:
2	chr15:34330614..34331132-chr22:21984221..21984750,2	NB4	blood:
3	chr15:34330538..34331100-chr16:778184..778756,2	HCT-116	colon:
4	chr15:34330030..34332710-chr15:35259474..35262090,2	MCF-7	breast:
5	chr15:34330374..34330923-chr15:34659512..34660213,2	K562	blood:
6	chr15:34330580..34331316-chrX:49028626..49029256,2	NB4	blood:
7	chr15:34320977..34323643-chr15:34328767..34331333,2	MCF-7	breast:
8	chr15:34329770..34332450-chr15:34500868..34502911,3	K562	blood:
9	chr12:54388393..54389358-chr15:34330438..34331617,3	Hela-S3	cervix:
10	chr15:34330580..34331391-chr19:10443789..10444410,2	NB4	blood:
11	chr12:49525016..49525540-chr15:34330682..34331291,2	HCT-116	colon:
12	chr1:231003799..231004442-chr15:34330464..34331002,2	Hela-S3	cervix:
13	chr15:34327076..34328752-chr15:34329743..34331266,2	MCF-7	breast:

No data

Variant related genes	Relation type
ENSG00000119280	Chromatin interaction
ENSG00000258017	Chromatin interaction
ENSG00000117450	Chromatin interaction
ENSG00000021776	Chromatin interaction
ENSG00000123416	Chromatin interaction
ENSG00000180806	Chromatin interaction
ENSG00000161179	Chromatin interaction
ENSG00000197757	Chromatin interaction
ENSG00000103253	Chromatin interaction
ENSG00000134152	Chromatin interaction
ENSG00000161847	Chromatin interaction

Extended variants
information (count: 5 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:5 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv456789	chr15:34034421-34426618	Weak transcription Enhancers Active TSS Flanking Active TSS Strong transcription ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
2	nsv568920	chr15:34034421-34426618	Enhancers Flanking Active TSS Strong transcription Weak transcription Active TSS Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
3	nsv471235	chr15:34035529-34421951	Strong transcription Weak transcription Enhancers Bivalent/Poised TSS Active TSS Flanking Active TSS Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
4	nsv903985	chr15:34279319-34370487	Flanking Active TSS Weak transcription Active TSS Enhancers ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
5	esv3368275	chr15:34330085-34332358	Active TSS Flanking Active TSS Enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	13 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:126 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr15:34329400-34331600	Active TSS	HUES48 Cell Line	embryonic stem cell
2	chr15:34329600-34331600	Active TSS	GM12878-XiMat	blood
3	chr15:34329800-34331600	Active TSS	HUES64 Cell Line	embryonic stem cell
4	chr15:34329800-34331600	Active TSS	iPS-20b Cell Line	embryonic stem cell
5	chr15:34330000-34331400	Active TSS	Foreskin Melanocyte Primary Cells skin03	Skin
6	chr15:34330000-34331600	Active TSS	H1 Cell Line	embryonic stem cell
7	chr15:34330000-34331600	Active TSS	HUES6 Cell Line	embryonic stem cell
8	chr15:34330000-34331600	Active TSS	Primary T cells fromperipheralblood	blood
9	chr15:34330000-34331600	Active TSS	Brain Germinal Matrix	brain
10	chr15:34330000-34331600	Active TSS	Fetal Intestine Large	intestine
11	chr15:34330000-34331600	Active TSS	Fetal Thymus	thymus
12	chr15:34330000-34331600	Active TSS	NH-A	brain
13	chr15:34330000-34331600	Active TSS	NHEK	skin
14	chr15:34330000-34331600	Active TSS	Osteobl	bone
15	chr15:34330000-34331800	Active TSS	ES-I3 Cell Line	embryonic stem cell
16	chr15:34330000-34331800	Active TSS	ES-WA7 Cell Line	embryonic stem cell
17	chr15:34330000-34331800	Active TSS	H9 Cell Line	embryonic stem cell
18	chr15:34330000-34331800	Active TSS	IMR90 fetal lung fibroblasts Cell Line	lung
19	chr15:34330000-34331800	Active TSS	ES-UCSF4 Cell Line	embryonic stem cell
20	chr15:34330000-34331800	Active TSS	Breast Myoepithelial Primary Cells	Breast
21	chr15:34330000-34331800	Active TSS	Foreskin Keratinocyte Primary Cells skin02	Skin
22	chr15:34330000-34331800	Active TSS	Brain Cingulate Gyrus	brain
23	chr15:34330000-34331800	Active TSS	Brain Inferior Temporal Lobe	brain
24	chr15:34330000-34331800	Active TSS	Brain Substantia Nigra	brain
25	chr15:34330000-34331800	Active TSS	Fetal Brain Female	brain
26	chr15:34330000-34331800	Active TSS	Pancreatic Islets	Pancreatic Islet
27	chr15:34330000-34331800	Active TSS	Thymus	Thymus
28	chr15:34330000-34332000	Active TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
29	chr15:34330000-34332000	Active TSS	Colonic Mucosa	Colon
30	chr15:34330000-34332000	Active TSS	Fetal Muscle Leg	muscle
31	chr15:34330000-34332000	Active TSS	Psoas Muscle	Psoas
32	chr15:34330000-34332000	Active TSS	Right Ventricle	heart
33	chr15:34330000-34332200	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
34	chr15:34330000-34332200	Active TSS	Foreskin Fibroblast Primary Cells skin02	Skin
35	chr15:34330000-34332200	Active TSS	Duodenum Smooth Muscle	Duodenum
36	chr15:34330000-34332400	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
37	chr15:34330200-34331400	Active TSS	HMEC	breast
38	chr15:34330200-34331600	Active TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
39	chr15:34330200-34331600	Active TSS	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
40	chr15:34330200-34331600	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
41	chr15:34330200-34331600	Active TSS	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
42	chr15:34330200-34331600	Active TSS	Primary Natural Killer cells fromperipheralblood	blood
43	chr15:34330200-34331600	Active TSS	Brain Dorsolateral Prefrontal Cortex	brain
44	chr15:34330200-34331600	Active TSS	Fetal Lung	lung
45	chr15:34330200-34331600	Active TSS	Placenta	Placenta
46	chr15:34330200-34331600	Active TSS	Hela-S3	cervix
47	chr15:34330200-34331600	Active TSS	NHDF-Ad	bronchial
48	chr15:34330200-34331800	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
49	chr15:34330200-34331800	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
50	chr15:34330200-34331800	Active TSS	iPS DF 19.11 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links