Variant report

Variant	rs145660325
Chromosome Location	chr1:158811514-158811515
allele	-/ATGACCAGGAAGAATCAGGGAAGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 10 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:10 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1006288	chr1:158684002-158844221	Enhancers Flanking Active TSS Active TSS Weak transcription Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
2	nsv535181	chr1:158684002-158844221	Enhancers Strong transcription Weak transcription Flanking Active TSS Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
3	nsv817245	chr1:158684003-158844220	Enhancers Active TSS Genic enhancers Weak transcription Transcr. at gene 5' and 3' Flanking Active TSS Strong transcription Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
4	nsv547988	chr1:158685036-158848064	Enhancers Genic enhancers Active TSS Strong transcription Flanking Active TSS Weak transcription Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
5	nsv547989	chr1:158685036-158852953	Enhancers Flanking Active TSS Weak transcription Active TSS Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
6	nsv1011085	chr1:158703583-158845135	Flanking Active TSS Active TSS Enhancers Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	9 gene(s)	inside rSNPs	diseases
7	nsv1002401	chr1:158712627-158972031	Flanking Active TSS Strong transcription Active TSS Weak transcription Enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
8	esv3376764	chr1:158761947-158998617	Enhancers Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Weak transcription Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
9	esv3344229	chr1:158811502-158811725	Active TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region	1 gene(s)	inside rSNPs	diseases
10	esv3322117	chr1:158811512-158811723	Weak transcription Transcr. at gene 5' and 3' Active TSS Genic enhancers	TF binding region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:9 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr1:158800800-158812200	Active TSS	Primary B cells from cord blood	blood
2	chr1:158805000-158812800	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
3	chr1:158808000-158812000	Transcr. at gene 5' and 3'	Monocytes-CD14+_RO01746	blood
4	chr1:158808600-158811800	Transcr. at gene 5' and 3'	Primary neutrophils fromperipheralblood	blood
5	chr1:158809600-158815000	Weak transcription	Primary B cells from peripheral blood	blood
6	chr1:158809800-158812600	Weak transcription	GM12878-XiMat	blood
7	chr1:158810000-158813800	Weak transcription	Spleen	Spleen
8	chr1:158810600-158814400	Genic enhancers	Primary monocytes fromperipheralblood	blood
9	chr1:158810800-158813800	Weak transcription	Primary hematopoietic stem cells	blood

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links