Variant report

Variant rs147235439
Chromosome Location chr21:47419787-47419788
allele -/GGGGAGACCCGTGAGGGTCATG
Outlinks Ensembl   UCSC
Chromatin state (count:79 , 50 per page) page: 1 2
No. Chromosome Location Chromatin state Cell line Tissue
1 chr21:47403200-47424600 Weak transcription Small Intestine intestine
2 chr21:47403200-47425000 Weak transcription Pancreatic Islets Pancreatic Islet
3 chr21:47404000-47424200 Strong transcription H1 Cell Line embryonic stem cell
4 chr21:47404000-47424600 Strong transcription Aorta Aorta
5 chr21:47404200-47425200 Strong transcription H9 Derived Neuron Cultured Cells ES cell derived
6 chr21:47404200-47425200 Strong transcription Muscle Satellite Cultured Cells --
7 chr21:47405000-47423800 Weak transcription Brain Inferior Temporal Lobe brain
8 chr21:47405000-47425400 Weak transcription Duodenum Mucosa Duodenum
9 chr21:47405200-47425400 Strong transcription HUES6 Cell Line embryonic stem cell
10 chr21:47405200-47425400 Strong transcription iPS-15b Cell Line embryonic stem cell
11 chr21:47405200-47425800 Weak transcription ES-I3 Cell Line embryonic stem cell
12 chr21:47405400-47423800 Weak transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
13 chr21:47405400-47424800 Strong transcription Fetal Brain Female brain
14 chr21:47405400-47425200 Strong transcription ES-UCSF4 Cell Line embryonic stem cell
15 chr21:47405600-47419800 Strong transcription Fetal Stomach stomach
16 chr21:47405600-47423000 Strong transcription Breast Myoepithelial Primary Cells Breast
17 chr21:47406400-47421400 Strong transcription Fetal Adrenal Gland Adrenal Gland
18 chr21:47406600-47425400 Weak transcription Brain Cingulate Gyrus brain
19 chr21:47407600-47425000 Weak transcription Rectal Mucosa Donor 29 rectum
20 chr21:47408400-47425800 Transcr. at gene 5' and 3' Foreskin Fibroblast Primary Cells skin02 Skin
21 chr21:47408600-47419800 Strong transcription Brain Germinal Matrix brain
22 chr21:47409000-47425200 Strong transcription HUES48 Cell Line embryonic stem cell
23 chr21:47409200-47425000 Strong transcription Ovary ovary
24 chr21:47409800-47426600 Weak transcription Brain Dorsolateral Prefrontal Cortex brain
25 chr21:47410000-47422600 Weak transcription Liver Liver
26 chr21:47411200-47432800 Weak transcription Right Atrium heart
27 chr21:47412400-47423000 Strong transcription Colonic Mucosa Colon
28 chr21:47412400-47426400 Weak transcription iPS-18 Cell Line embryonic stem cell
29 chr21:47412600-47422400 Weak transcription Brain Hippocampus Middle brain
30 chr21:47412600-47425800 Weak transcription iPS-20b Cell Line embryonic stem cell
31 chr21:47413600-47420200 Genic enhancers iPS DF 19.11 Cell Line embryonic stem cell
32 chr21:47413800-47425200 Strong transcription NHLF lung
33 chr21:47414000-47421200 Strong transcription Spleen Spleen
34 chr21:47414200-47424800 Strong transcription Right Ventricle heart
35 chr21:47414600-47421200 Strong transcription Placenta Placenta
36 chr21:47414800-47425200 Strong transcription Osteobl bone
37 chr21:47415200-47425200 Strong transcription Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
38 chr21:47415400-47420400 Strong transcription Skeletal Muscle Male skeletal muscle
39 chr21:47415400-47420800 Strong transcription NHDF-Ad bronchial
40 chr21:47415400-47422200 Weak transcription HSMMtube muscle
41 chr21:47415400-47423400 Weak transcription HSMM muscle
42 chr21:47415400-47424600 Strong transcription hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
43 chr21:47415400-47424600 Strong transcription Adipose Nuclei Adipose
44 chr21:47415400-47425000 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
45 chr21:47415400-47425000 Weak transcription Brain Anterior Caudate brain
46 chr21:47415600-47425400 Strong transcription Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
47 chr21:47415800-47420000 Strong transcription Fetal Muscle Leg muscle
48 chr21:47415800-47420200 Strong transcription Fetal Muscle Trunk muscle
49 chr21:47416000-47425400 Strong transcription Fetal Intestine Small intestine
50 chr21:47416200-47422800 Strong transcription Colon Smooth Muscle Colon

Quick Search:


  
Input of quick search could be:

what's new

Quick links