Variant report

Variant	rs149221978
Chromosome Location	chr6:30348408-30348409
allele	-/CGCACACACACACACACACGCG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 2 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:2 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1025667	chr6:30292845-30638066	Flanking Active TSS Weak transcription Strong transcription Active TSS Flanking Bivalent TSS/Enh Enhancers Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	825 gene(s)	inside rSNPs	diseases
2	nsv348940	chr6:30348394-30348429	Inactive region	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:0 , 50 per page) page:

No data

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links