Variant report

Variant rs149286879
Chromosome Location chr12:58238986-58238987
allele -/GCCCCAGCCTCCGGGGCCAGGTG
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr12:58235200-58239000 Flanking Active TSS Primary T helper cells fromperipheralblood blood
2 chr12:58236200-58239000 Transcr. at gene 5' and 3' Fetal Stomach stomach
3 chr12:58236200-58239400 Transcr. at gene 5' and 3' IMR90 fetal lung fibroblasts Cell Line lung
4 chr12:58236200-58239400 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
5 chr12:58236400-58239200 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Female --
6 chr12:58236600-58239200 Flanking Active TSS Primary hematopoietic stem cells short term culture blood
7 chr12:58237000-58239000 Flanking Active TSS Cortex derived primary cultured neurospheres brain
8 chr12:58237000-58241000 Active TSS Aorta Aorta
9 chr12:58237200-58241200 Active TSS Ovary ovary
10 chr12:58237400-58239000 Flanking Active TSS Primary T cells fromperipheralblood blood
11 chr12:58237400-58239400 Flanking Active TSS Primary neutrophils fromperipheralblood blood
12 chr12:58237400-58241200 Active TSS Pancreatic Islets Pancreatic Islet
13 chr12:58237600-58239200 Flanking Active TSS Primary T regulatory cells fromperipheralblood blood
14 chr12:58237600-58241000 Active TSS Rectal Smooth Muscle rectum
15 chr12:58237600-58241400 Active TSS Brain Substantia Nigra brain
16 chr12:58237600-58241400 Active TSS Fetal Kidney kidney
17 chr12:58237800-58241000 Active TSS Duodenum Smooth Muscle Duodenum
18 chr12:58237800-58241200 Active TSS Colon Smooth Muscle Colon
19 chr12:58238000-58239000 Flanking Active TSS Foreskin Keratinocyte Primary Cells skin02 Skin
20 chr12:58238000-58239400 Flanking Active TSS Primary hematopoietic stem cells blood
21 chr12:58238000-58239600 Flanking Active TSS Primary B cells from cord blood blood
22 chr12:58238000-58240200 Flanking Active TSS Primary mononuclear cells fromperipheralblood Blood
23 chr12:58238000-58241000 Active TSS Brain Anterior Caudate brain
24 chr12:58238000-58241000 Active TSS Brain Dorsolateral Prefrontal Cortex brain
25 chr12:58238000-58241000 Active TSS HSMMtube muscle
26 chr12:58238000-58241200 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
27 chr12:58238200-58239000 Flanking Active TSS Primary B cells from peripheral blood blood
28 chr12:58238200-58239000 Flanking Active TSS HUVEC blood vessel
29 chr12:58238200-58239000 Flanking Active TSS K562 blood
30 chr12:58238200-58239200 Flanking Active TSS Primary Natural Killer cells fromperipheralblood blood
31 chr12:58238200-58239200 Flanking Active TSS Dnd41 blood
32 chr12:58238200-58241000 Active TSS Brain Inferior Temporal Lobe brain
33 chr12:58238400-58240400 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
34 chr12:58238400-58240800 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
35 chr12:58238400-58240800 Active TSS Primary T helper naive cells from peripheral blood blood
36 chr12:58238400-58240800 Active TSS Primary T helper cells PMA-I stimulated --
37 chr12:58238400-58240800 Active TSS Sigmoid Colon Sigmoid Colon
38 chr12:58238400-58240800 Active TSS Small Intestine intestine
39 chr12:58238400-58241000 Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
40 chr12:58238400-58241000 Active TSS H9 Cell Line embryonic stem cell
41 chr12:58238400-58241000 Active TSS Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
42 chr12:58238400-58241000 Active TSS Brain Angular Gyrus brain
43 chr12:58238400-58241000 Active TSS Right Ventricle heart
44 chr12:58238400-58241000 Active TSS Stomach Smooth Muscle stomach
45 chr12:58238400-58241000 Active TSS Thymus Thymus
46 chr12:58238400-58241000 Active TSS NHLF lung
47 chr12:58238400-58241000 Active TSS Osteobl bone
48 chr12:58238400-58241200 Active TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
49 chr12:58238400-58241200 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
50 chr12:58238400-58241200 Active TSS Breast Myoepithelial Primary Cells Breast

Quick Search:


  
Input of quick search could be:

what's new

Quick links