Variant report

Variant rs193922856
Chromosome Location chr19:39055987-39055988
allele -/CAGCAGTGACGCGCGCTGGG
Outlinks Ensembl   UCSC
Chromatin state (count:65 , 50 per page) page: 1 2
No. Chromosome Location Chromatin state Cell line Tissue
1 chr19:38985200-39081800 Weak transcription Psoas Muscle Psoas
2 chr19:39035200-39066400 Strong transcription Skeletal Muscle Male skeletal muscle
3 chr19:39036000-39076400 Weak transcription Brain Substantia Nigra brain
4 chr19:39051000-39056200 Weak transcription Primary T helper naive cells from peripheral blood blood
5 chr19:39051600-39066400 Strong transcription Skeletal Muscle Female skeletal muscle
6 chr19:39051800-39056200 Weak transcription Primary T killer memory cells from peripheral blood blood
7 chr19:39051800-39056400 Weak transcription Primary T helper memory cells from peripheral blood 2 blood
8 chr19:39053200-39077800 Weak transcription Brain Hippocampus Middle brain
9 chr19:39053200-39086800 Weak transcription Brain Angular Gyrus brain
10 chr19:39053200-39086800 Weak transcription Brain Inferior Temporal Lobe brain
11 chr19:39053400-39075400 Weak transcription Brain Anterior Caudate brain
12 chr19:39053800-39056000 Weak transcription Brain Cingulate Gyrus brain
13 chr19:39053800-39061400 Weak transcription Brain Dorsolateral Prefrontal Cortex brain
14 chr19:39055000-39056000 Bivalent Enhancer Fetal Muscle Trunk muscle
15 chr19:39055000-39056800 Enhancers Primary Natural Killer cells fromperipheralblood blood
16 chr19:39055000-39057200 Weak transcription HSMMtube muscle
17 chr19:39055200-39056000 Enhancers Primary T helper memory cells from peripheral blood 1 blood
18 chr19:39055400-39056000 Active TSS Right Ventricle heart
19 chr19:39055400-39056400 Bivalent/Poised TSS HUES6 Cell Line embryonic stem cell
20 chr19:39055400-39056400 Bivalent/Poised TSS iPS-15b Cell Line embryonic stem cell
21 chr19:39055400-39056400 Bivalent/Poised TSS Colonic Mucosa Colon
22 chr19:39055400-39056400 Bivalent/Poised TSS Duodenum Smooth Muscle Duodenum
23 chr19:39055400-39056600 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
24 chr19:39055400-39056800 Bivalent Enhancer Primary hematopoietic stem cells short term culture blood
25 chr19:39055400-39056800 Enhancers Primary T killer naive cells fromperipheralblood blood
26 chr19:39055400-39056800 Enhancers GM12878-XiMat blood
27 chr19:39055400-39058400 Weak transcription H9 Cell Line embryonic stem cell
28 chr19:39055600-39056000 Enhancers ES-UCSF4 Cell Line embryonic stem cell
29 chr19:39055600-39056000 Enhancers Primary T helper 17 cells PMA-I stimulated --
30 chr19:39055600-39056000 Active TSS Primary T helper cells fromperipheralblood blood
31 chr19:39055600-39056000 Bivalent/Poised TSS Foreskin Fibroblast Primary Cells skin02 Skin
32 chr19:39055600-39056000 Active TSS Foreskin Melanocyte Primary Cells skin03 Skin
33 chr19:39055600-39056000 Active TSS Lung lung
34 chr19:39055600-39056000 Bivalent/Poised TSS Monocytes-CD14+_RO01746 blood
35 chr19:39055600-39056200 Bivalent/Poised TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
36 chr19:39055600-39056200 Active TSS Primary T regulatory cells fromperipheralblood blood
37 chr19:39055600-39056200 Active TSS Primary T cells effector/memory enriched fromperipheralblood blood
38 chr19:39055600-39056200 Active TSS Ganglion Eminence derived primary cultured neurospheres brain
39 chr19:39055600-39056200 Bivalent/Poised TSS Foreskin Keratinocyte Primary Cells skin02 Skin
40 chr19:39055600-39056200 Bivalent/Poised TSS Duodenum Mucosa Duodenum
41 chr19:39055600-39056400 Bivalent/Poised TSS HUES48 Cell Line embryonic stem cell
42 chr19:39055600-39056400 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
43 chr19:39055600-39056400 Bivalent/Poised TSS Brain Germinal Matrix brain
44 chr19:39055600-39056400 Bivalent/Poised TSS Fetal Brain Female brain
45 chr19:39055600-39056400 Enhancers Pancreas Pancrea
46 chr19:39055600-39056400 Bivalent/Poised TSS Thymus Thymus
47 chr19:39055600-39056400 Active TSS A549 lung
48 chr19:39055600-39056600 Bivalent/Poised TSS HUES64 Cell Line embryonic stem cell
49 chr19:39055600-39056600 Enhancers Spleen Spleen
50 chr19:39055800-39056000 Bivalent Enhancer Primary hematopoietic stem cells G-CSF-mobilized Male --

Quick Search:


  
Input of quick search could be:

what's new

Quick links