Variant report

Variant rs199656228
Chromosome Location chr5:14664996-14664997
allele -/CGGCGCGGGAGGCGGCGGCCA
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr5:14663400-14665600 Active TSS Duodenum Smooth Muscle Duodenum
2 chr5:14663400-14665800 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
3 chr5:14663400-14665800 Active TSS A549 lung
4 chr5:14663600-14665200 Active TSS ES-I3 Cell Line embryonic stem cell
5 chr5:14663600-14665400 Active TSS H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
6 chr5:14663600-14665600 Active TSS Foreskin Keratinocyte Primary Cells skin03 Skin
7 chr5:14663600-14666000 Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
8 chr5:14663600-14666000 Active TSS Foreskin Melanocyte Primary Cells skin03 Skin
9 chr5:14663600-14666000 Active TSS NHLF lung
10 chr5:14663600-14666200 Bivalent/Poised TSS iPS-20b Cell Line embryonic stem cell
11 chr5:14663600-14666200 Active TSS GM12878-XiMat blood
12 chr5:14663800-14665200 Flanking Active TSS Primary mononuclear cells fromperipheralblood Blood
13 chr5:14663800-14665400 Active TSS Fetal Lung lung
14 chr5:14663800-14665600 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
15 chr5:14663800-14665600 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
16 chr5:14663800-14665600 Bivalent/Poised TSS HUES64 Cell Line embryonic stem cell
17 chr5:14663800-14665600 Active TSS ES-UCSF4 Cell Line embryonic stem cell
18 chr5:14663800-14665800 Active TSS H9 Cell Line embryonic stem cell
19 chr5:14663800-14665800 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
20 chr5:14663800-14665800 Active TSS Brain Inferior Temporal Lobe brain
21 chr5:14663800-14665800 Active TSS Colon Smooth Muscle Colon
22 chr5:14663800-14665800 Active TSS Esophagus oesophagus
23 chr5:14663800-14665800 Active TSS Sigmoid Colon Sigmoid Colon
24 chr5:14663800-14665800 Active TSS Small Intestine intestine
25 chr5:14663800-14665800 Active TSS Stomach Mucosa stomach
26 chr5:14663800-14665800 Active TSS HSMMtube muscle
27 chr5:14663800-14666000 Active TSS ES-WA7 Cell Line embryonic stem cell
28 chr5:14663800-14666000 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
29 chr5:14663800-14666000 Active TSS Foreskin Fibroblast Primary Cells skin01 Skin
30 chr5:14663800-14666000 Active TSS Foreskin Melanocyte Primary Cells skin01 Skin
31 chr5:14663800-14666000 Active TSS Colonic Mucosa Colon
32 chr5:14663800-14666000 Active TSS Left Ventricle heart
33 chr5:14663800-14666000 Active TSS Psoas Muscle Psoas
34 chr5:14663800-14666000 Active TSS NHDF-Ad bronchial
35 chr5:14663800-14666200 Active TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
36 chr5:14663800-14666200 Active TSS Foreskin Fibroblast Primary Cells skin02 Skin
37 chr5:14663800-14666200 Active TSS Aorta Aorta
38 chr5:14663800-14666200 Active TSS Lung lung
39 chr5:14663800-14666200 Active TSS Ovary ovary
40 chr5:14663800-14666200 Active TSS HMEC breast
41 chr5:14663800-14666600 Active TSS Pancreatic Islets Pancreatic Islet
42 chr5:14664000-14665000 Transcr. at gene 5' and 3' Primary T helper 17 cells PMA-I stimulated --
43 chr5:14664000-14665400 Active TSS HUES6 Cell Line embryonic stem cell
44 chr5:14664000-14665400 Active TSS Brain Hippocampus Middle brain
45 chr5:14664000-14665400 Active TSS Duodenum Mucosa Duodenum
46 chr5:14664000-14665400 Active TSS Fetal Adrenal Gland Adrenal Gland
47 chr5:14664000-14665400 Active TSS HSMM muscle
48 chr5:14664000-14665600 Active TSS H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
49 chr5:14664000-14665600 Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
50 chr5:14664000-14665600 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived

Quick Search:


  
Input of quick search could be:

what's new

Quick links