Variant report

Variant rs201631176
Chromosome Location chr1:144991404-144991405
allele -/ACACACACACACACACACAG
Outlinks Ensembl   UCSC
Chromatin state (count:83 , 50 per page) page: 1 2
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:144983000-144997600 Weak transcription Primary T helper naive cells from peripheral blood blood
2 chr1:144983200-144992000 Weak transcription Primary Natural Killer cells fromperipheralblood blood
3 chr1:144983400-144991800 Weak transcription H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
4 chr1:144983400-144991800 Weak transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
5 chr1:144983400-144994000 Weak transcription H1 Cell Line embryonic stem cell
6 chr1:144983400-144994200 Weak transcription ES-I3 Cell Line embryonic stem cell
7 chr1:144983400-144994200 Weak transcription iPS-18 Cell Line embryonic stem cell
8 chr1:144983800-144991800 Weak transcription HUES6 Cell Line embryonic stem cell
9 chr1:144985800-144993400 Enhancers Pancreatic Islets Pancreatic Islet
10 chr1:144987000-144993000 Weak transcription Lung lung
11 chr1:144987000-144994400 Weak transcription H1 Derived Mesenchymal Stem Cells ES cell derived
12 chr1:144987800-144991800 Weak transcription Primary T killer memory cells from peripheral blood blood
13 chr1:144988000-144996400 Genic enhancers Brain Germinal Matrix brain
14 chr1:144988600-144991600 Flanking Active TSS Skeletal Muscle Male skeletal muscle
15 chr1:144988600-144991800 Weak transcription Primary T cells from cord blood blood
16 chr1:144988800-144991800 Enhancers Foreskin Melanocyte Primary Cells skin01 Skin
17 chr1:144989000-144992200 Enhancers Fetal Brain Female brain
18 chr1:144989000-144993000 Enhancers Foreskin Melanocyte Primary Cells skin03 Skin
19 chr1:144989000-144993800 Transcr. at gene 5' and 3' K562 blood
20 chr1:144989600-144992400 Enhancers Fetal Intestine Large intestine
21 chr1:144989800-144991600 Flanking Active TSS Fetal Heart heart
22 chr1:144989800-144991800 Weak transcription Placenta Amnion Placenta Amnion
23 chr1:144989800-144991800 Active TSS Right Ventricle heart
24 chr1:144989800-144991800 Enhancers NHLF lung
25 chr1:144989800-144992800 Weak transcription hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
26 chr1:144989800-144994200 Weak transcription Fetal Kidney kidney
27 chr1:144989800-144995400 Active TSS Left Ventricle heart
28 chr1:144990000-144991600 Weak transcription Primary mononuclear cells fromperipheralblood Blood
29 chr1:144990000-144991600 Enhancers Fetal Muscle Leg muscle
30 chr1:144990000-144991800 Weak transcription H9 Cell Line embryonic stem cell
31 chr1:144990000-144991800 Weak transcription iPS DF 6.9 Cell Line embryonic stem cell
32 chr1:144990000-144991800 Weak transcription Breast Myoepithelial Primary Cells Breast
33 chr1:144990000-144991800 Weak transcription Foreskin Keratinocyte Primary Cells skin02 Skin
34 chr1:144990000-144991800 Enhancers Brain Anterior Caudate brain
35 chr1:144990000-144991800 Weak transcription NHEK skin
36 chr1:144990000-144992000 Weak transcription Cortex derived primary cultured neurospheres brain
37 chr1:144990000-144992200 Enhancers Colon Smooth Muscle Colon
38 chr1:144990000-144992600 Weak transcription Fetal Stomach stomach
39 chr1:144990000-144993000 Weak transcription iPS DF 19.11 Cell Line embryonic stem cell
40 chr1:144990000-144993000 Weak transcription Gastric stomach
41 chr1:144990000-144993000 Genic enhancers HSMM muscle
42 chr1:144990000-144994600 Weak transcription NH-A brain
43 chr1:144990000-144998800 Weak transcription Sigmoid Colon Sigmoid Colon
44 chr1:144990200-144992200 Enhancers Fetal Brain Male brain
45 chr1:144990400-144991600 Weak transcription Rectal Mucosa Donor 31 rectum
46 chr1:144990400-144991800 Weak transcription Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
47 chr1:144990400-144993000 Weak transcription IMR90 fetal lung fibroblasts Cell Line lung
48 chr1:144990400-144993000 Weak transcription Primary hematopoietic stem cells short term culture blood
49 chr1:144990600-144991600 Weak transcription Osteobl bone
50 chr1:144990600-144991800 Enhancers Stomach Smooth Muscle stomach

Quick Search:


  
Input of quick search could be:

what's new

Quick links