Variant report

Variant	rs202104287
Chromosome Location	chr5:35842256-35842257
allele	-/TATATATAGGTATATATATC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 3 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1022761	chr5:35775802-35902546	Enhancers Weak transcription Genic enhancers Flanking Active TSS Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Strong transcription Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
2	esv3379714	chr5:35841120-35843568	Active TSS Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS	n/a	n/a	inside rSNPs	diseases
3	esv3421897	chr5:35841595-35843093	ZNF genes & repeats Enhancers Weak transcription Active TSS	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:5 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:35841600-35842600	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
2	chr5:35841600-35842600	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
3	chr5:35841600-35845200	Weak transcription	Primary T killer memory cells from peripheral blood	blood
4	chr5:35841800-35842800	Weak transcription	Primary T helper cells PMA-I stimulated	--
5	chr5:35842000-35842400	Weak transcription	Primary T helper 17 cells PMA-I stimulated	--

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links