Variant report

Variant rs3215222
Chromosome Location chr1:226069947-226069948
allele -/CCCGACGTGGACCCGGCCCCGCAC
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:226066400-226070000 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
2 chr1:226067000-226070000 Flanking Active TSS Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
3 chr1:226067200-226070000 Flanking Active TSS Dnd41 blood
4 chr1:226067200-226071000 Flanking Active TSS Primary mononuclear cells fromperipheralblood Blood
5 chr1:226067800-226070000 Flanking Active TSS Primary hematopoietic stem cells blood
6 chr1:226067800-226070000 Flanking Active TSS Skeletal Muscle Female skeletal muscle
7 chr1:226068200-226070000 Flanking Active TSS Brain Dorsolateral Prefrontal Cortex brain
8 chr1:226068600-226070600 Transcr. at gene 5' and 3' Primary T regulatory cells fromperipheralblood blood
9 chr1:226068600-226071200 Active TSS Primary T helper memory cells from peripheral blood 1 blood
10 chr1:226068600-226072000 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
11 chr1:226068800-226070000 Flanking Active TSS Foreskin Melanocyte Primary Cells skin01 Skin
12 chr1:226068800-226071000 Active TSS Lung lung
13 chr1:226068800-226071200 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
14 chr1:226068800-226071200 Active TSS Primary T helper memory cells from peripheral blood 2 blood
15 chr1:226068800-226071200 Active TSS Aorta Aorta
16 chr1:226069000-226071000 Active TSS ES-WA7 Cell Line embryonic stem cell
17 chr1:226069000-226071000 Active TSS Primary T killer memory cells from peripheral blood blood
18 chr1:226069000-226071000 Active TSS Sigmoid Colon Sigmoid Colon
19 chr1:226069000-226071000 Active TSS Small Intestine intestine
20 chr1:226069000-226071200 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
21 chr1:226069000-226071200 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
22 chr1:226069000-226071200 Active TSS Primary T helper naive cells from peripheral blood blood
23 chr1:226069000-226071200 Active TSS Fetal Kidney kidney
24 chr1:226069000-226071200 Active TSS Pancreatic Islets Pancreatic Islet
25 chr1:226069000-226071200 Active TSS Pancreas Pancrea
26 chr1:226069000-226071400 Active TSS H9 Cell Line embryonic stem cell
27 chr1:226069200-226070000 Flanking Bivalent TSS/Enh Fetal Brain Female brain
28 chr1:226069200-226070800 Bivalent/Poised TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
29 chr1:226069200-226070800 Active TSS Primary T cells from cord blood blood
30 chr1:226069200-226071000 Active TSS Stomach Mucosa stomach
31 chr1:226069200-226071000 Bivalent/Poised TSS HepG2 liver
32 chr1:226069200-226071000 Active TSS HSMMtube muscle
33 chr1:226069200-226071200 Active TSS Primary T killer naive cells fromperipheralblood blood
34 chr1:226069200-226071200 Active TSS Ovary ovary
35 chr1:226069200-226071200 Active TSS NHDF-Ad bronchial
36 chr1:226069400-226070200 Active TSS ES-UCSF4 Cell Line embryonic stem cell
37 chr1:226069400-226070400 Active TSS IMR90 fetal lung fibroblasts Cell Line lung
38 chr1:226069400-226070400 Active TSS iPS-18 Cell Line embryonic stem cell
39 chr1:226069400-226070400 Active TSS NH-A brain
40 chr1:226069400-226070400 Active TSS NHEK skin
41 chr1:226069400-226070600 Active TSS Primary T cells fromperipheralblood blood
42 chr1:226069400-226070600 Active TSS Colonic Mucosa Colon
43 chr1:226069400-226070600 Active TSS Thymus Thymus
44 chr1:226069400-226070800 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
45 chr1:226069400-226070800 Active TSS HUES48 Cell Line embryonic stem cell
46 chr1:226069400-226070800 Active TSS iPS-15b Cell Line embryonic stem cell
47 chr1:226069400-226070800 Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
48 chr1:226069400-226070800 Active TSS Primary B cells from peripheral blood blood
49 chr1:226069400-226070800 Active TSS Brain Hippocampus Middle brain
50 chr1:226069400-226070800 Active TSS Skeletal Muscle Male skeletal muscle

Quick Search:


  
Input of quick search could be:

what's new

Quick links