Variant report

Variant rs3217060
Chromosome Location chr11:64072302-64072303
allele -/TGCGGTGACCGAATGAAGGTCAC
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr11:64071200-64072400 Flanking Active TSS Stomach Smooth Muscle stomach
2 chr11:64071200-64072400 Flanking Active TSS Monocytes-CD14+_RO01746 blood
3 chr11:64071200-64073000 Flanking Active TSS Foreskin Fibroblast Primary Cells skin02 Skin
4 chr11:64071400-64072400 Flanking Active TSS Primary hematopoietic stem cells short term culture blood
5 chr11:64071400-64072400 Flanking Active TSS Colonic Mucosa Colon
6 chr11:64071400-64072400 Flanking Active TSS Rectal Mucosa Donor 29 rectum
7 chr11:64071400-64072400 Flanking Active TSS Skeletal Muscle Female skeletal muscle
8 chr11:64071400-64072400 Flanking Active TSS Dnd41 blood
9 chr11:64071600-64072400 Flanking Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
10 chr11:64071600-64072400 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
11 chr11:64071600-64072400 Flanking Active TSS Primary monocytes fromperipheralblood blood
12 chr11:64071600-64072400 Flanking Active TSS Primary neutrophils fromperipheralblood blood
13 chr11:64071600-64072400 Flanking Active TSS Primary T helper naive cells fromperipheralblood blood
14 chr11:64071600-64072400 Flanking Active TSS Primary T helper 17 cells PMA-I stimulated --
15 chr11:64071600-64072400 Flanking Active TSS Primary T helper cells fromperipheralblood blood
16 chr11:64071600-64072400 Flanking Active TSS Primary T regulatory cells fromperipheralblood blood
17 chr11:64071600-64072400 Flanking Active TSS Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
18 chr11:64071600-64072400 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Female --
19 chr11:64071600-64072400 Flanking Active TSS Foreskin Keratinocyte Primary Cells skin03 Skin
20 chr11:64071600-64072400 Flanking Active TSS Adipose Nuclei Adipose
21 chr11:64071600-64072400 Flanking Active TSS Liver Liver
22 chr11:64071600-64072400 Flanking Active TSS Brain Angular Gyrus brain
23 chr11:64071600-64072400 Flanking Active TSS Brain Germinal Matrix brain
24 chr11:64071600-64072400 Flanking Active TSS Fetal Intestine Large intestine
25 chr11:64071600-64072400 Flanking Active TSS HMEC breast
26 chr11:64071600-64072400 Flanking Active TSS NH-A brain
27 chr11:64071600-64072400 Flanking Active TSS Osteobl bone
28 chr11:64071600-64072600 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
29 chr11:64071600-64073600 Active TSS Fetal Lung lung
30 chr11:64071800-64072400 Flanking Active TSS IMR90 fetal lung fibroblasts Cell Line lung
31 chr11:64071800-64072400 Flanking Active TSS Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
32 chr11:64071800-64072400 Flanking Active TSS Primary B cells from cord blood blood
33 chr11:64071800-64072400 Flanking Active TSS Primary B cells from peripheral blood blood
34 chr11:64071800-64072400 Flanking Active TSS Primary hematopoietic stem cells blood
35 chr11:64071800-64072400 Flanking Active TSS Primary T helper naive cells from peripheral blood blood
36 chr11:64071800-64072400 Flanking Active TSS Primary T helper memory cells from peripheral blood 1 blood
37 chr11:64071800-64072400 Flanking Active TSS Primary Natural Killer cells fromperipheralblood blood
38 chr11:64071800-64072400 Flanking Active TSS Primary T killer naive cells fromperipheralblood blood
39 chr11:64071800-64072400 Flanking Active TSS Fetal Adrenal Gland Adrenal Gland
40 chr11:64071800-64072400 Active TSS Fetal Heart heart
41 chr11:64071800-64072400 Flanking Active TSS Fetal Intestine Small intestine
42 chr11:64071800-64072400 Flanking Active TSS Fetal Muscle Trunk muscle
43 chr11:64071800-64072400 Flanking Active TSS Fetal Muscle Leg muscle
44 chr11:64071800-64072400 Flanking Active TSS Placenta Placenta
45 chr11:64071800-64072400 Flanking Active TSS Fetal Thymus thymus
46 chr11:64071800-64072400 Flanking Active TSS Pancreas Pancrea
47 chr11:64071800-64072400 Flanking Active TSS Stomach Mucosa stomach
48 chr11:64071800-64072400 Flanking Active TSS HUVEC blood vessel
49 chr11:64071800-64072400 Flanking Active TSS NHEK skin
50 chr11:64071800-64072600 Active TSS ES-I3 Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links