Variant report

Variant	rs34303833
Chromosome Location	chr10:43052387-43052388
allele	-/GTTGCTGCCAGCACACTGGAATG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	MAX	chr10:43052383-43052902	HepG2	liver:	n/a	n/a
2	HEY1	chr10:43052339-43052700	HepG2	liver:	n/a	n/a
3	MAX	chr10:43052326-43052737	HepG2	liver:	n/a	n/a

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr10:43048254..43049868-chr10:43050241..43052640,2	K562	blood:

Variant related genes	Relation type
ZNF37BP	TF binding region
ENSG00000234420	Chromatin interaction

Extended variants
information (count: 21 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:21 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv817455	chr10:42607635-43151812	Active TSS Weak transcription Strong transcription Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	29 gene(s)	inside rSNPs	diseases
2	nsv550670	chr10:42725663-43089965	Strong transcription Bivalent/Poised TSS Active TSS ZNF genes & repeats Weak transcription Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
3	nsv550672	chr10:42753190-43441729	Bivalent Enhancer Genic enhancers Weak transcription Strong transcription Active TSS Enhancers Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
4	nsv895054	chr10:42761931-43068841	ZNF genes & repeats Flanking Active TSS Weak transcription Bivalent/Poised TSS Active TSS Enhancers Strong transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
5	nsv895064	chr10:42783481-43243325	Flanking Active TSS Strong transcription Bivalent/Poised TSS ZNF genes & repeats Weak transcription Active TSS Genic enhancers Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	27 gene(s)	inside rSNPs	diseases
6	nsv466877	chr10:42794125-43066414	Weak transcription ZNF genes & repeats Flanking Active TSS Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Strong transcription Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
7	nsv550683	chr10:42794125-43066414	Weak transcription Flanking Active TSS ZNF genes & repeats Enhancers Active TSS Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
8	nsv533331	chr10:42830221-43356410	ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent/Poised TSS Active TSS Genic enhancers Strong transcription Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	35 gene(s)	inside rSNPs	diseases
9	nsv1042764	chr10:42846383-43511712	Flanking Active TSS Strong transcription Bivalent/Poised TSS ZNF genes & repeats Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	50 gene(s)	inside rSNPs	diseases
10	nsv895071	chr10:42864138-43066414	ZNF genes & repeats Strong transcription Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
11	nsv895073	chr10:42884169-43066505	Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Genic enhancers Weak transcription Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
12	nsv1050394	chr10:42890663-43604956	Enhancers Weak transcription Active TSS Bivalent Enhancer Strong transcription Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	53 gene(s)	inside rSNPs	diseases
13	nsv540573	chr10:42890663-43604956	Strong transcription Bivalent Enhancer Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	53 gene(s)	inside rSNPs	diseases
14	nsv534548	chr10:42890664-43729688	Weak transcription Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	56 gene(s)	inside rSNPs	diseases
15	nsv469725	chr10:42965130-43178323	Active TSS Strong transcription Flanking Active TSS ZNF genes & repeats Enhancers Weak transcription Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
16	nsv482513	chr10:42965130-43178323	Weak transcription ZNF genes & repeats Active TSS Strong transcription Enhancers Flanking Active TSS Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
17	esv2758216	chr10:42965131-43510191	Flanking Active TSS Enhancers Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription Active TSS Bivalent Enhancer Weak transcription Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	49 gene(s)	inside rSNPs	diseases
18	esv2759746	chr10:42965131-43510191	Weak transcription Bivalent Enhancer Bivalent/Poised TSS Strong transcription Active TSS Flanking Active TSS ZNF genes & repeats Enhancers Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	49 gene(s)	inside rSNPs	diseases
19	nsv947884	chr10:43051168-43067229	Enhancers Weak transcription Flanking Active TSS	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
20	esv994700	chr10:43052386-43052408	Weak transcription Enhancers Flanking Active TSS	TF binding region Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
21	esv1630969	chr10:43052387-43052410	Enhancers Flanking Active TSS Weak transcription	TF binding region Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:3 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr10:43049200-43052400	Weak transcription	Rectal Mucosa Donor 29	rectum
2	chr10:43051400-43052600	Flanking Active TSS	HepG2	liver
3	chr10:43052200-43052600	Enhancers	Lung	lung

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links