Variant report

Variant	rs35963244
Chromosome Location	chr5:178846563-178846564
allele	-/ACAAATATCATCACACACAAAAGTGTGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr5:178844770..178846299-chr5:178846428..178847929,2	MCF-7	breast:
2	chr12:72186780..72187498-chr5:178846162..178846680,2	MCF-7	breast:

Extended variants
information (count: 68 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:68 , 50 per page) page: 1 2

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1024560	chr5:178415364-178917595	Weak transcription Enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
2	nsv537975	chr5:178415364-178917595	Weak transcription Enhancers Bivalent Enhancer ZNF genes & repeats Genic enhancers Strong transcription Bivalent/Poised TSS Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
3	nsv817413	chr5:178415365-179020558	Weak transcription Enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Strong transcription Bivalent Enhancer Active TSS Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	40 gene(s)	inside rSNPs	diseases
4	nsv1016097	chr5:178544084-178866001	Enhancers Bivalent Enhancer Active TSS Bivalent/Poised TSS Genic enhancers Weak transcription Strong transcription ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
5	nsv1026968	chr5:178545479-178865895	Bivalent Enhancer Enhancers Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats Active TSS Bivalent/Poised TSS Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
6	nsv537976	chr5:178545479-178865895	Enhancers ZNF genes & repeats Weak transcription Genic enhancers Active TSS Flanking Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
7	nsv1018641	chr5:178627012-178911254	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Enhancers Genic enhancers Flanking Active TSS Active TSS Strong transcription Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
8	nsv537978	chr5:178627012-178911254	Flanking Bivalent TSS/Enh Enhancers Weak transcription Genic enhancers Flanking Active TSS Strong transcription ZNF genes & repeats Bivalent Enhancer Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
9	esv2758031	chr5:178661266-179037529	ZNF genes & repeats Enhancers Bivalent Enhancer Weak transcription Flanking Active TSS Strong transcription Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	32 gene(s)	inside rSNPs	diseases
10	esv2759397	chr5:178661266-179037529	Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	32 gene(s)	inside rSNPs	diseases
11	nsv531996	chr5:178669297-178989687	Enhancers Active TSS Weak transcription Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Strong transcription Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	32 gene(s)	inside rSNPs	diseases
12	nsv883235	chr5:178719364-178869884	Bivalent Enhancer Enhancers Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Weak transcription ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
13	nsv1022321	chr5:178720968-178925831	Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Weak transcription Genic enhancers Active TSS Strong transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
14	nsv1024805	chr5:178720968-178931310	Bivalent Enhancer Weak transcription Active TSS Enhancers Strong transcription Genic enhancers Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
15	nsv883237	chr5:178720968-178936722	Strong transcription Enhancers Weak transcription Bivalent Enhancer Genic enhancers Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
16	esv34709	chr5:178720968-178961710	Bivalent Enhancer Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
17	esv2757148	chr5:178720968-178961872	Bivalent Enhancer Enhancers Weak transcription Flanking Active TSS Genic enhancers Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
18	nsv883239	chr5:178722356-178874091	Enhancers Active TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Strong transcription Flanking Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
19	nsv883240	chr5:178722356-178921861	Bivalent Enhancer Genic enhancers Enhancers Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
20	nsv883241	chr5:178722356-178935665	Genic enhancers Enhancers Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Active TSS Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
21	nsv883242	chr5:178722356-178936722	Weak transcription Bivalent Enhancer Enhancers Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
22	nsv883243	chr5:178722356-178944407	Bivalent/Poised TSS Enhancers Genic enhancers Bivalent Enhancer Flanking Active TSS Weak transcription Active TSS ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
23	nsv883246	chr5:178724727-178869884	Bivalent Enhancer Enhancers Flanking Active TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
24	nsv883247	chr5:178724727-178925558	Genic enhancers Enhancers Weak transcription Bivalent/Poised TSS Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Flanking Active TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
25	nsv883248	chr5:178724727-178935665	Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Weak transcription Active TSS Genic enhancers Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
26	nsv883249	chr5:178724727-178936722	Bivalent Enhancer Strong transcription Weak transcription Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Bivalent/Poised TSS Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
27	nsv883250	chr5:178724727-178944407	Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Enhancers Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' Flanking Active TSS Active TSS Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
28	esv3390865	chr5:178726226-178947989	ZNF genes & repeats Enhancers Weak transcription Genic enhancers Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
29	nsv1024564	chr5:178727497-178909460	ZNF genes & repeats Enhancers Bivalent Enhancer Weak transcription Genic enhancers Active TSS Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
30	nsv537979	chr5:178727497-178909460	ZNF genes & repeats Flanking Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Active TSS Strong transcription Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
31	nsv1021553	chr5:178727497-178917347	Strong transcription Flanking Bivalent TSS/Enh Enhancers Weak transcription Genic enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
32	nsv537980	chr5:178727497-178917347	Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Genic enhancers Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
33	nsv883251	chr5:178728830-178903149	Enhancers Active TSS Weak transcription Genic enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
34	nsv433375	chr5:178728830-178935665	Weak transcription Flanking Active TSS Enhancers Bivalent Enhancer Bivalent/Poised TSS Active TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
35	nsv462579	chr5:178728830-178935665	Enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Weak transcription ZNF genes & repeats Genic enhancers Strong transcription Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
36	nsv462580	chr5:178728830-178935665	Weak transcription Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Genic enhancers Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
37	nsv462581	chr5:178728830-178935665	Enhancers Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Active TSS ZNF genes & repeats Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
38	nsv600502	chr5:178728830-178935665	Weak transcription Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Enhancers Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
39	nsv462582	chr5:178728830-178936722	Weak transcription Flanking Bivalent TSS/Enh Enhancers Active TSS Genic enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
40	nsv600503	chr5:178728830-178936722	ZNF genes & repeats Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Weak transcription Active TSS Strong transcription Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
41	nsv883252	chr5:178728830-178936722	Enhancers Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer Genic enhancers Weak transcription ZNF genes & repeats Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
42	nsv462584	chr5:178728830-178944407	Weak transcription Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
43	nsv471061	chr5:178728830-178944407	Enhancers Bivalent Enhancer Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
44	nsv600504	chr5:178728830-178944407	Bivalent/Poised TSS Enhancers Weak transcription ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
45	nsv1020794	chr5:178729576-178923464	Weak transcription Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3' Genic enhancers Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
46	nsv1015647	chr5:178729576-178931310	Enhancers Weak transcription ZNF genes & repeats Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Strong transcription Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
47	nsv441979	chr5:178729588-178931306	Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Enhancers Bivalent Enhancer Weak transcription ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
48	nsv883253	chr5:178731921-178928962	Active TSS Bivalent Enhancer Enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
49	nsv883254	chr5:178735068-178936722	Flanking Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Bivalent/Poised TSS Strong transcription Genic enhancers Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
50	nsv1030029	chr5:178742960-178897857	Flanking Active TSS Enhancers Bivalent Enhancer Weak transcription Active TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:178842600-178848400	Weak transcription	Spleen	Spleen

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links