Variant report

Variant	rs367869498
Chromosome Location	chr2:191319702-191319703
allele	-/ATGTATATGTATATGTATATGTATA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr2:191318515..191323057-chr2:191332501..191335066,4	MCF-7	breast:

Variant related genes	Relation type
ENSG00000151690	Chromatin interaction

Extended variants
information (count: 2 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:2 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv33134	chr2:191318791-191365710	Strong transcription Weak transcription Genic enhancers Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
2	nsv962094	chr2:191318806-191324621	Weak transcription Genic enhancers Enhancers Strong transcription ZNF genes & repeats Flanking Active TSS	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:68 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr2:191302200-191321200	Weak transcription	Esophagus	oesophagus
2	chr2:191302400-191331000	Weak transcription	A549	lung
3	chr2:191302800-191320200	Weak transcription	Fetal Thymus	thymus
4	chr2:191302800-191321200	Weak transcription	Primary hematopoietic stem cells short term culture	blood
5	chr2:191303400-191321000	Weak transcription	Thymus	Thymus
6	chr2:191303400-191321200	Weak transcription	Dnd41	blood
7	chr2:191303600-191321000	Weak transcription	Monocytes-CD14+_RO01746	blood
8	chr2:191303800-191321000	Weak transcription	Primary monocytes fromperipheralblood	blood
9	chr2:191303800-191331600	Weak transcription	Brain Germinal Matrix	brain
10	chr2:191303800-191332600	Weak transcription	Fetal Intestine Large	intestine
11	chr2:191306600-191321000	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
12	chr2:191306600-191351000	Weak transcription	Pancreas	Pancrea
13	chr2:191307600-191322600	Weak transcription	Aorta	Aorta
14	chr2:191308000-191328800	Weak transcription	Primary T helper 17 cells PMA-I stimulated	--
15	chr2:191308800-191320000	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
16	chr2:191308800-191327200	Weak transcription	Right Atrium	heart
17	chr2:191309200-191322400	Weak transcription	Fetal Muscle Leg	muscle
18	chr2:191309400-191331400	Weak transcription	Stomach Smooth Muscle	stomach
19	chr2:191310200-191323600	Weak transcription	Primary T helper naive cells from peripheral blood	blood
20	chr2:191310400-191331600	Weak transcription	Stomach Mucosa	stomach
21	chr2:191311400-191324200	Weak transcription	Fetal Heart	heart
22	chr2:191311600-191321400	Weak transcription	Rectal Mucosa Donor 29	rectum
23	chr2:191311600-191321400	Weak transcription	Rectal Mucosa Donor 31	rectum
24	chr2:191311600-191331400	Weak transcription	Sigmoid Colon	Sigmoid Colon
25	chr2:191311800-191324600	Weak transcription	Left Ventricle	heart
26	chr2:191311800-191331400	Weak transcription	IMR90 fetal lung fibroblasts Cell Line	lung
27	chr2:191311800-191331400	Weak transcription	Rectal Smooth Muscle	rectum
28	chr2:191311800-191331600	Weak transcription	Ovary	ovary
29	chr2:191312000-191332400	Weak transcription	Duodenum Smooth Muscle	Duodenum
30	chr2:191312200-191321200	Weak transcription	Fetal Stomach	stomach
31	chr2:191312200-191324400	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
32	chr2:191313000-191321200	Weak transcription	Gastric	stomach
33	chr2:191313000-191331400	Weak transcription	HSMMtube	muscle
34	chr2:191313000-191333600	Weak transcription	Foreskin Melanocyte Primary Cells skin01	Skin
35	chr2:191313800-191323600	Weak transcription	Brain Anterior Caudate	brain
36	chr2:191314000-191331600	Weak transcription	Fetal Kidney	kidney
37	chr2:191315800-191327400	Weak transcription	Spleen	Spleen
38	chr2:191316400-191321400	Weak transcription	Lung	lung
39	chr2:191316600-191321800	Weak transcription	Primary B cells from cord blood	blood
40	chr2:191316600-191323400	Weak transcription	Primary T helper memory cells from peripheral blood 2	blood
41	chr2:191316600-191324600	Weak transcription	Brain Inferior Temporal Lobe	brain
42	chr2:191316600-191325200	Weak transcription	Brain Dorsolateral Prefrontal Cortex	brain
43	chr2:191316600-191331200	Weak transcription	NHLF	lung
44	chr2:191317000-191323600	Weak transcription	Fetal Adrenal Gland	Adrenal Gland
45	chr2:191317600-191321800	Strong transcription	Primary T cells fromperipheralblood	blood
46	chr2:191317600-191331600	Weak transcription	Foreskin Melanocyte Primary Cells skin03	Skin
47	chr2:191318000-191319800	Weak transcription	Brain Angular Gyrus	brain
48	chr2:191318000-191322800	Strong transcription	Primary T helper cells fromperipheralblood	blood
49	chr2:191318600-191320400	Weak transcription	Primary hematopoietic stem cells	blood
50	chr2:191318600-191321200	Weak transcription	K562	blood

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links