Variant report

Variant	rs367975097
Chromosome Location	chr11:5519923-5519924
allele	-/CTTTACTTCTTAAGATACACC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 12 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:12 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1048608	chr11:5328516-5645179	Enhancers Flanking Active TSS Weak transcription Strong transcription Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	60 gene(s)	inside rSNPs	diseases
2	nsv1046068	chr11:5335943-6063742	Strong transcription Weak transcription Active TSS ZNF genes & repeats Flanking Active TSS Enhancers Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	89 gene(s)	inside rSNPs	diseases
3	nsv832057	chr11:5375585-5576200	Weak transcription ZNF genes & repeats Strong transcription Enhancers Flanking Active TSS Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	51 gene(s)	inside rSNPs	diseases
4	nsv896939	chr11:5497799-5809548	Enhancers Active TSS Weak transcription Strong transcription Flanking Active TSS Genic enhancers Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	48 gene(s)	inside rSNPs	diseases
5	nsv1042308	chr11:5504861-5520062	Enhancers Genic enhancers Active TSS Transcr. at gene 5' and 3' Strong transcription ZNF genes & repeats Flanking Active TSS	TF binding region CpG island Chromatin interactive region	5 gene(s)	inside rSNPs	diseases
6	nsv467670	chr11:5506034-5550630	Strong transcription Enhancers Active TSS Weak transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
7	nsv553240	chr11:5506034-5550630	Enhancers Bivalent Enhancer Strong transcription Flanking Active TSS Weak transcription Transcr. at gene 5' and 3' ZNF genes & repeats Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
8	nsv553241	chr11:5506034-6203685	Genic enhancers Strong transcription Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	74 gene(s)	inside rSNPs	diseases
9	nsv553242	chr11:5518911-5522874	Transcr. at gene 5' and 3' Genic enhancers	Chromatin interactive region	4 gene(s)	inside rSNPs	diseases
10	nsv553243	chr11:5518911-5525654	Genic enhancers Transcr. at gene 5' and 3'	Chromatin interactive region	10 gene(s)	inside rSNPs	diseases
11	nsv553244	chr11:5519195-5522874	Transcr. at gene 5' and 3' Genic enhancers	Chromatin interactive region	4 gene(s)	inside rSNPs	diseases
12	esv3455853	chr11:5519576-5524974	Transcr. at gene 5' and 3' Genic enhancers	Chromatin interactive region	8 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr11:5519600-5520200	Genic enhancers	K562	blood

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links