Variant report

Variant rs368396787
Chromosome Location chr1:171457200-171457201
allele -/CAGAAGTTCTGGCTCATTCC
Outlinks Ensembl   UCSC
Chromatin state (count:136 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:171453600-171457400 Active TSS GM12878-XiMat blood
2 chr1:171453600-171458200 Active TSS Foreskin Keratinocyte Primary Cells skin02 Skin
3 chr1:171453800-171457600 Active TSS Foreskin Fibroblast Primary Cells skin01 Skin
4 chr1:171454000-171457800 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
5 chr1:171455400-171457600 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
6 chr1:171455600-171458000 Flanking Active TSS HUVEC blood vessel
7 chr1:171455600-171458200 Flanking Active TSS Primary T helper cells PMA-I stimulated --
8 chr1:171455600-171461600 Weak transcription H1 Derived Mesenchymal Stem Cells ES cell derived
9 chr1:171455800-171457600 Flanking Active TSS Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
10 chr1:171455800-171457600 Weak transcription Esophagus oesophagus
11 chr1:171455800-171459000 Enhancers Stomach Mucosa stomach
12 chr1:171455800-171461600 Weak transcription Gastric stomach
13 chr1:171455800-171465400 Weak transcription Lung lung
14 chr1:171455800-171467800 Weak transcription Spleen Spleen
15 chr1:171456000-171457200 Flanking Active TSS Rectal Mucosa Donor 29 rectum
16 chr1:171456000-171457400 Flanking Active TSS Pancreatic Islets Pancreatic Islet
17 chr1:171456000-171457400 Flanking Active TSS NHEK skin
18 chr1:171456000-171457600 Flanking Active TSS Muscle Satellite Cultured Cells --
19 chr1:171456000-171459000 Weak transcription Pancreas Pancrea
20 chr1:171456000-171481800 Weak transcription Placenta Placenta
21 chr1:171456200-171457200 Weak transcription Primary Natural Killer cells fromperipheralblood blood
22 chr1:171456200-171457400 Transcr. at gene 5' and 3' Dnd41 blood
23 chr1:171456200-171457600 Weak transcription H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
24 chr1:171456200-171457800 Enhancers Cortex derived primary cultured neurospheres brain
25 chr1:171456200-171457800 Enhancers Rectal Smooth Muscle rectum
26 chr1:171456200-171458000 Flanking Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
27 chr1:171456200-171458000 Enhancers Primary neutrophils fromperipheralblood blood
28 chr1:171456200-171458000 Enhancers Fetal Adrenal Gland Adrenal Gland
29 chr1:171456200-171458000 Enhancers Placenta Amnion Placenta Amnion
30 chr1:171456200-171459800 Enhancers Fetal Heart heart
31 chr1:171456200-171461600 Weak transcription Left Ventricle heart
32 chr1:171456200-171467800 Weak transcription Fetal Muscle Trunk muscle
33 chr1:171456200-171475000 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
34 chr1:171456400-171457200 Active TSS HUES64 Cell Line embryonic stem cell
35 chr1:171456400-171457400 Enhancers Primary hematopoietic stem cells blood
36 chr1:171456400-171457400 Weak transcription Aorta Aorta
37 chr1:171456400-171457400 Weak transcription Ovary ovary
38 chr1:171456400-171457400 Weak transcription Right Atrium heart
39 chr1:171456400-171457400 Active TSS HMEC breast
40 chr1:171456400-171457400 Enhancers HSMM muscle
41 chr1:171456400-171457600 Weak transcription H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
42 chr1:171456400-171457600 Weak transcription Brain Inferior Temporal Lobe brain
43 chr1:171456400-171457800 Weak transcription Foreskin Melanocyte Primary Cells skin01 Skin
44 chr1:171456400-171457800 Enhancers Rectal Mucosa Donor 31 rectum
45 chr1:171456400-171458000 Enhancers Primary hematopoietic stem cells G-CSF-mobilized Female --
46 chr1:171456400-171458000 Enhancers Brain Dorsolateral Prefrontal Cortex brain
47 chr1:171456400-171458000 Enhancers Osteobl bone
48 chr1:171456400-171458200 Enhancers Brain Cingulate Gyrus brain
49 chr1:171456400-171458400 Enhancers Brain Hippocampus Middle brain
50 chr1:171456400-171458400 Enhancers Skeletal Muscle Female skeletal muscle

Quick Search:


  
Input of quick search could be:

what's new

Quick links