Variant report

Variant	rs372016960
Chromosome Location	chr14:72007404-72007405
allele	-/TTGTTAGAACAGAATTTTCCTC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 3 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv498021	chr14:71874708-72128721	Strong transcription Weak transcription ZNF genes & repeats Enhancers Active TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
2	esv3398985	chr14:71927884-72404676	Flanking Active TSS Weak transcription Enhancers ZNF genes & repeats Strong transcription Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
3	esv3434831	chr14:72006971-72007475	Active TSS Enhancers Weak transcription Flanking Active TSS	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:55 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr14:71976800-72008400	Weak transcription	Thymus	Thymus
2	chr14:71978400-72009400	Weak transcription	Primary T killer memory cells from peripheral blood	blood
3	chr14:71978400-72014800	Weak transcription	HMEC	breast
4	chr14:71980000-72021200	Weak transcription	Hela-S3	cervix
5	chr14:71981400-72021400	Weak transcription	Duodenum Mucosa	Duodenum
6	chr14:71981600-72008400	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
7	chr14:71997000-72009000	Weak transcription	ES-UCSF4 Cell Line	embryonic stem cell
8	chr14:71997400-72008400	Weak transcription	Primary T helper 17 cells PMA-I stimulated	--
9	chr14:71997800-72017600	Weak transcription	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
10	chr14:71998400-72008600	Weak transcription	Primary T helper cells fromperipheralblood	blood
11	chr14:72001400-72009800	Enhancers	Fetal Heart	heart
12	chr14:72002400-72009200	Enhancers	Fetal Adrenal Gland	Adrenal Gland
13	chr14:72002600-72007600	Enhancers	Muscle Satellite Cultured Cells	--
14	chr14:72002800-72008600	Enhancers	Fetal Stomach	stomach
15	chr14:72003000-72017800	Weak transcription	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
16	chr14:72003400-72007600	Enhancers	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
17	chr14:72003600-72008400	Enhancers	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
18	chr14:72003800-72009400	Weak transcription	HSMM	muscle
19	chr14:72004400-72007600	Enhancers	Cortex derived primary cultured neurospheres	brain
20	chr14:72004600-72007800	Enhancers	NHDF-Ad	bronchial
21	chr14:72005600-72007600	Enhancers	Primary T cells from cord blood	blood
22	chr14:72005800-72007600	Enhancers	Adipose Nuclei	Adipose
23	chr14:72005800-72008400	Enhancers	Fetal Muscle Leg	muscle
24	chr14:72005800-72008600	Enhancers	Primary B cells from peripheral blood	blood
25	chr14:72006200-72008400	Enhancers	Primary hematopoietic stem cells G-CSF-mobilized Female	--
26	chr14:72006400-72007800	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung
27	chr14:72006400-72008400	Enhancers	Left Ventricle	heart
28	chr14:72006400-72009400	Enhancers	Spleen	Spleen
29	chr14:72006600-72007600	Enhancers	Fetal Muscle Trunk	muscle
30	chr14:72006600-72019400	Weak transcription	Primary T helper cells PMA-I stimulated	--
31	chr14:72006600-72021800	Weak transcription	Small Intestine	intestine
32	chr14:72006800-72007600	Enhancers	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
33	chr14:72006800-72007800	Enhancers	Osteobl	bone
34	chr14:72006800-72008000	Weak transcription	Breast Myoepithelial Primary Cells	Breast
35	chr14:72006800-72008400	Weak transcription	Fetal Kidney	kidney
36	chr14:72007000-72007800	Enhancers	Brain Hippocampus Middle	brain
37	chr14:72007000-72008400	Enhancers	Primary hematopoietic stem cells G-CSF-mobilized Male	--
38	chr14:72007000-72009000	Enhancers	Fetal Lung	lung
39	chr14:72007000-72011200	Weak transcription	Right Ventricle	heart
40	chr14:72007200-72007600	Enhancers	Brain Anterior Caudate	brain
41	chr14:72007200-72007600	Enhancers	Brain Cingulate Gyrus	brain
42	chr14:72007200-72007600	Enhancers	Brain Inferior Temporal Lobe	brain
43	chr14:72007200-72007800	Enhancers	Right Atrium	heart
44	chr14:72007200-72008200	Weak transcription	Fetal Thymus	thymus
45	chr14:72007200-72008400	Weak transcription	GM12878-XiMat	blood
46	chr14:72007200-72019600	Weak transcription	Primary B cells from cord blood	blood
47	chr14:72007200-72020200	Weak transcription	Rectal Mucosa Donor 31	rectum
48	chr14:72007200-72021800	Weak transcription	Primary hematopoietic stem cells	blood
49	chr14:72007400-72007600	Enhancers	NH-A	brain
50	chr14:72007400-72007800	Enhancers	Fetal Brain Male	brain

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links