Variant report

Variant	rs372322463
Chromosome Location	chr7:146572989-146572990
allele	-/TACACACACGCACACACACACA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr7:146570862..146573024-chr7:146579800..146582486,2	K562	blood:

Extended variants
information (count: 22 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:22 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1022547	chr7:146226298-146624409	Enhancers Weak transcription Active TSS Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	5 gene(s)	inside rSNPs	diseases
2	nsv996300	chr7:146236230-146663300	Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region	5 gene(s)	inside rSNPs	diseases
3	nsv1027561	chr7:146308783-146762872	Weak transcription Active TSS Enhancers Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
4	nsv608940	chr7:146367793-146660924	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
5	nsv531440	chr7:146399958-146691013	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
6	nsv465191	chr7:146406379-146759900	Enhancers Active TSS Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
7	nsv608941	chr7:146406379-146759900	Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
8	nsv916776	chr7:146410718-146610220	Active TSS Enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
9	nsv932939	chr7:146420644-146587922	Enhancers Active TSS Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent/Poised TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
10	nsv931854	chr7:146440190-146663300	Enhancers Active TSS Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
11	nsv916943	chr7:146445929-146682066	Enhancers ZNF genes & repeats Flanking Active TSS Weak transcription Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
12	nsv522917	chr7:146446767-146694441	Weak transcription Active TSS Enhancers Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
13	nsv933923	chr7:146450952-146690007	ZNF genes & repeats Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
14	nsv1017163	chr7:146451346-146663301	Enhancers Weak transcription Active TSS Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
15	nsv539177	chr7:146451346-146663301	Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
16	nsv531441	chr7:146451347-146663300	Enhancers Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
17	nsv534580	chr7:146451347-146730531	Enhancers Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
18	nsv1021251	chr7:146522341-146802125	Enhancers Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
19	nsv497792	chr7:146526101-146734852	Enhancers Flanking Active TSS Weak transcription Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
20	nsv933723	chr7:146567637-146659437	Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
21	nsv523284	chr7:146570960-146586456	Enhancers Weak transcription ZNF genes & repeats	Chromatin interactive region	n/a	inside rSNPs	diseases
22	nsv519590	chr7:146571183-146590150	Enhancers ZNF genes & repeats Weak transcription	Chromatin interactive region	n/a	inside rSNPs	diseases

No data

Chromatin state (count:14 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr7:146571800-146573200	Enhancers	Fetal Brain Male	brain
2	chr7:146571800-146573800	Enhancers	iPS-18 Cell Line	embryonic stem cell
3	chr7:146572000-146573400	Enhancers	HUES48 Cell Line	embryonic stem cell
4	chr7:146572000-146573400	Enhancers	iPS-15b Cell Line	embryonic stem cell
5	chr7:146572000-146574000	Enhancers	HUES6 Cell Line	embryonic stem cell
6	chr7:146572000-146574200	Enhancers	HUES64 Cell Line	embryonic stem cell
7	chr7:146572200-146573400	Enhancers	iPS-20b Cell Line	embryonic stem cell
8	chr7:146572200-146573600	Enhancers	Fetal Brain Female	brain
9	chr7:146572400-146573400	Enhancers	Fetal Stomach	stomach
10	chr7:146572600-146573400	Enhancers	H1 Cell Line	embryonic stem cell
11	chr7:146572600-146573400	Enhancers	H9 Cell Line	embryonic stem cell
12	chr7:146572600-146573600	Enhancers	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
13	chr7:146572800-146573200	Enhancers	Ovary	ovary
14	chr7:146572800-146574000	Enhancers	ES-I3 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links