Variant report

Variant	rs372674089
Chromosome Location	chr9:72298727-72298728
allele	-/TTGTTTCCTAATTGTAAAAAATA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 3 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv471309	chr9:72273898-72410323	Weak transcription Genic enhancers Strong transcription Enhancers Flanking Active TSS Bivalent Enhancer Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	10 gene(s)	inside rSNPs	diseases
2	esv3397197	chr9:72298160-72299128	Inactive region	Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
3	esv3327668	chr9:72298252-72298740	Inactive region	Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:0 , 50 per page) page:

No data

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links