Variant report

Variant	rs373468952
Chromosome Location	chr1:166541306-166541307
allele	-/ATATTGATATAGAGATGATGGGGACAT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 10 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:10 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv916491	chr1:166000783-166948513	Bivalent/Poised TSS Weak transcription Active TSS Enhancers Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
2	esv2757759	chr1:166491879-166650985	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent Enhancer Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
3	esv2758975	chr1:166491879-166650985	ZNF genes & repeats Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
4	nsv872511	chr1:166505186-166590046	ZNF genes & repeats Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
5	nsv872512	chr1:166532565-166581706	Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
6	nsv872513	chr1:166532565-166590046	Weak transcription Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
7	nsv872514	chr1:166532565-166595209	Weak transcription Enhancers Flanking Active TSS Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
8	nsv872515	chr1:166532565-166595692	Enhancers Flanking Active TSS Weak transcription Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
9	nsv872516	chr1:166536198-166590046	Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
10	nsv872517	chr1:166539001-166590046	Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:0 , 50 per page) page:

No data

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links