Variant report

Variant	rs373523957
Chromosome Location	chr3:48372326-48372327
allele	-/CAGGCCGGGCGCGGTGGCTC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 2 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:2 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv834683	chr3:48301504-48493261	Weak transcription Active TSS Flanking Active TSS Strong transcription Enhancers ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	73 gene(s)	inside rSNPs	diseases
2	nsv967015	chr3:48370774-48381957	Weak transcription Enhancers Active TSS Flanking Active TSS Bivalent Enhancer	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:4 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr3:48363000-48373400	Weak transcription	Primary neutrophils fromperipheralblood	blood
2	chr3:48371400-48373200	Weak transcription	Breast Myoepithelial Primary Cells	Breast
3	chr3:48371400-48373600	Weak transcription	Primary monocytes fromperipheralblood	blood
4	chr3:48372200-48377600	Enhancers	Placenta	Placenta

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links