Variant report

Variant	rs374484136
Chromosome Location	chr6:77257107-77257108
allele	-/ATATATGATATAGCATATATATATC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 17 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:17 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1025439	chr6:77093795-77479689	Enhancers Active TSS Weak transcription ZNF genes & repeats Bivalent Enhancer Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
2	nsv538320	chr6:77093795-77479689	Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
3	nsv886205	chr6:77103194-77266188	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
4	nsv830699	chr6:77111857-77291223	ZNF genes & repeats Enhancers Weak transcription Genic enhancers Flanking Active TSS Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
5	nsv886207	chr6:77130167-77266188	Enhancers Bivalent Enhancer Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
6	nsv886208	chr6:77130167-77317683	Enhancers Flanking Active TSS Weak transcription Active TSS ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Strong transcription Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
7	nsv886210	chr6:77192263-77317683	Active TSS Genic enhancers Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
8	nsv886211	chr6:77208816-77317683	Active TSS Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
9	nsv886212	chr6:77208816-77340148	Weak transcription Enhancers ZNF genes & repeats Active TSS Transcr. at gene 5' and 3' Flanking Active TSS Genic enhancers Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
10	nsv886213	chr6:77212059-77317683	Weak transcription Enhancers ZNF genes & repeats Active TSS Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
11	nsv830700	chr6:77246037-77382238	Weak transcription Enhancers ZNF genes & repeats Active TSS Flanking Active TSS Transcr. at gene 5' and 3' Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
12	nsv886214	chr6:77247004-77317683	ZNF genes & repeats Enhancers Weak transcription Active TSS Genic enhancers Flanking Active TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
13	esv3346348	chr6:77255858-77258406	Enhancers Weak transcription	n/a	n/a	inside rSNPs	n/a
14	esv3338836	chr6:77255983-77258131	Enhancers Weak transcription	n/a	n/a	inside rSNPs	n/a
15	esv3339075	chr6:77256433-77257781	Enhancers Weak transcription	n/a	n/a	inside rSNPs	n/a
16	esv3327238	chr6:77256672-77257174	Weak transcription	n/a	n/a	inside rSNPs	n/a
17	esv3342836	chr6:77256961-77257144	Weak transcription	n/a	n/a	inside rSNPs	n/a

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr6:77245200-77257800	Weak transcription	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links