Variant report

Variant	rs375611893
Chromosome Location	chr7:12519282-12519283
allele	-/TGTGTGTGTGTGTGTGTGTA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr7:12516830..12519772-chr7:12523106..12525607,3	K562	blood:
2	chr7:12511799..12514210-chr7:12517629..12520508,2	K562	blood:
3	chr7:12511799..12515284-chr7:12517629..12521714,3	K562	blood:

Extended variants
information (count: 27 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:27 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv534432	chr7:12148960-12693032	Enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Strong transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	23 gene(s)	inside rSNPs	diseases
2	nsv1024554	chr7:12214722-12967418	Active TSS Flanking Active TSS ZNF genes & repeats Weak transcription Enhancers Strong transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	58 gene(s)	inside rSNPs	diseases
3	nsv538735	chr7:12214722-12967418	Bivalent/Poised TSS Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer Strong transcription Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	58 gene(s)	inside rSNPs	diseases
4	nsv464373	chr7:12406826-12536336	Enhancers Active TSS Weak transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
5	nsv606224	chr7:12406826-12536336	Enhancers Flanking Active TSS Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
6	nsv464376	chr7:12429488-12526282	Flanking Bivalent TSS/Enh Enhancers Active TSS Flanking Active TSS Bivalent/Poised TSS Weak transcription ZNF genes & repeats Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region	7 gene(s)	inside rSNPs	diseases
7	nsv606227	chr7:12429488-12526282	Active TSS Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Weak transcription Bivalent Enhancer ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region	7 gene(s)	inside rSNPs	diseases
8	esv1801371	chr7:12498138-12522283	Enhancers Flanking Active TSS Weak transcription Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
9	esv2757212	chr7:12505613-12596535	Enhancers Active TSS Weak transcription ZNF genes & repeats Flanking Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
10	esv2759511	chr7:12505613-12596535	Weak transcription Active TSS Enhancers Flanking Active TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
11	nsv1017055	chr7:12509227-12553217	Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Weak transcription	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
12	nsv464377	chr7:12512802-12564128	Enhancers Active TSS Flanking Active TSS Weak transcription	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
13	nsv606228	chr7:12512802-12564128	Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
14	nsv8048	chr7:12514460-12564736	Active TSS Flanking Active TSS Enhancers Weak transcription	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
15	esv3692921	chr7:12515906-12564128	Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
16	nsv464378	chr7:12516170-12562500	Enhancers Active TSS Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
17	nsv606229	chr7:12516170-12562500	Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
18	nsv519965	chr7:12516170-12564128	Active TSS Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
19	nsv470055	chr7:12516170-12564128	Weak transcription Enhancers Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
20	nsv606230	chr7:12516170-12564128	Active TSS Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
21	nsv818482	chr7:12516170-12564128	Enhancers Active TSS Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
22	nsv1028361	chr7:12517477-12548420	Enhancers Active TSS Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
23	nsv1027185	chr7:12517477-12549015	Active TSS Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
24	nsv1022047	chr7:12517477-12552147	Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
25	nsv1027708	chr7:12517477-12558257	Enhancers Active TSS Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
26	esv2761074	chr7:12517477-12566200	Active TSS Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
27	nsv887640	chr7:12519212-12543794	Enhancers Active TSS Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr7:12515600-12521000	Weak transcription	HUES48 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links