Variant report

Variant	rs377650993
Chromosome Location	chr5:96317962-96317963
allele	-/TTTGTACATTGTTATCTCCAGTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 8 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:8 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv432755	chr5:95987984-96657483	Weak transcription Enhancers Strong transcription Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	66 gene(s)	inside rSNPs	diseases
2	nsv598962	chr5:96057891-96893164	Weak transcription Strong transcription Enhancers Bivalent/Poised TSS Genic enhancers Flanking Active TSS Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	49 gene(s)	inside rSNPs	diseases
3	nsv948703	chr5:96078309-96368839	Weak transcription Flanking Active TSS Active TSS Enhancers Strong transcription Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	32 gene(s)	inside rSNPs	diseases
4	nsv1027472	chr5:96081592-96337550	Strong transcription Genic enhancers Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	28 gene(s)	inside rSNPs	diseases
5	nsv1028741	chr5:96082401-96372165	Enhancers Weak transcription Strong transcription Genic enhancers Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	32 gene(s)	inside rSNPs	diseases
6	nsv949058	chr5:96082433-96390619	Enhancers Weak transcription Flanking Active TSS Strong transcription Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	33 gene(s)	inside rSNPs	diseases
7	nsv598963	chr5:96084776-96363407	Weak transcription Enhancers Genic enhancers Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	28 gene(s)	inside rSNPs	diseases
8	nsv969268	chr5:96317607-96327820	Strong transcription Weak transcription Enhancers ZNF genes & repeats Genic enhancers	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:112 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:96304600-96329600	Weak transcription	Fetal Brain Female	brain
2	chr5:96304600-96335600	Weak transcription	Stomach Mucosa	stomach
3	chr5:96304800-96346600	Weak transcription	Lung	lung
4	chr5:96304800-96359600	Weak transcription	Hela-S3	cervix
5	chr5:96305400-96334200	Weak transcription	Brain Cingulate Gyrus	brain
6	chr5:96313200-96325400	Weak transcription	Placenta Amnion	Placenta Amnion
7	chr5:96313200-96330000	Weak transcription	HSMMtube	muscle
8	chr5:96313400-96342600	Weak transcription	ES-I3 Cell Line	embryonic stem cell
9	chr5:96313400-96342600	Weak transcription	HUES6 Cell Line	embryonic stem cell
10	chr5:96314000-96318000	Strong transcription	Primary T cells from cord blood	blood
11	chr5:96314000-96360200	Weak transcription	Fetal Brain Male	brain
12	chr5:96314200-96343600	Strong transcription	Primary B cells from peripheral blood	blood
13	chr5:96314200-96344000	Strong transcription	Primary B cells from cord blood	blood
14	chr5:96314200-96347600	Strong transcription	Fetal Thymus	thymus
15	chr5:96314400-96318000	Strong transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
16	chr5:96314400-96318000	Strong transcription	Fetal Intestine Large	intestine
17	chr5:96314400-96319200	Strong transcription	Primary T cells fromperipheralblood	blood
18	chr5:96314400-96319600	Strong transcription	Primary T regulatory cells fromperipheralblood	blood
19	chr5:96314400-96343800	Strong transcription	Dnd41	blood
20	chr5:96314600-96318200	Strong transcription	Primary T helper cells PMA-I stimulated	--
21	chr5:96314600-96319000	Strong transcription	Primary Natural Killer cells fromperipheralblood	blood
22	chr5:96314800-96318200	Strong transcription	Primary hematopoietic stem cells G-CSF-mobilized Male	--
23	chr5:96314800-96319800	Strong transcription	Primary hematopoietic stem cells short term culture	blood
24	chr5:96314800-96343200	Strong transcription	Primary monocytes fromperipheralblood	blood
25	chr5:96314800-96343800	Strong transcription	Monocytes-CD14+_RO01746	blood
26	chr5:96315000-96318000	Strong transcription	Primary T helper cells fromperipheralblood	blood
27	chr5:96315000-96318000	Strong transcription	Adipose Nuclei	Adipose
28	chr5:96315000-96318000	Strong transcription	Rectal Mucosa Donor 29	rectum
29	chr5:96315000-96318200	Strong transcription	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
30	chr5:96315000-96318400	Strong transcription	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
31	chr5:96315000-96331000	Strong transcription	Placenta	Placenta
32	chr5:96315400-96320800	Weak transcription	Small Intestine	intestine
33	chr5:96315400-96374800	Weak transcription	Foreskin Melanocyte Primary Cells skin01	Skin
34	chr5:96315600-96318400	Strong transcription	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
35	chr5:96315600-96319200	Weak transcription	H1 Derived Mesenchymal Stem Cells	ES cell derived
36	chr5:96315600-96320200	Weak transcription	IMR90 fetal lung fibroblasts Cell Line	lung
37	chr5:96315600-96320200	Weak transcription	Fetal Intestine Small	intestine
38	chr5:96315600-96320600	Weak transcription	Pancreatic Islets	Pancreatic Islet
39	chr5:96315600-96320800	Weak transcription	Foreskin Keratinocyte Primary Cells skin02	Skin
40	chr5:96315600-96321400	Weak transcription	Primary T helper memory cells from peripheral blood 2	blood
41	chr5:96315600-96321400	Weak transcription	Foreskin Fibroblast Primary Cells skin02	Skin
42	chr5:96315600-96321400	Weak transcription	Aorta	Aorta
43	chr5:96315600-96321400	Weak transcription	Fetal Adrenal Gland	Adrenal Gland
44	chr5:96315600-96321400	Weak transcription	Fetal Stomach	stomach
45	chr5:96315600-96321400	Weak transcription	Gastric	stomach
46	chr5:96315600-96321400	Weak transcription	Left Ventricle	heart
47	chr5:96315600-96321400	Weak transcription	Sigmoid Colon	Sigmoid Colon
48	chr5:96315600-96321400	Weak transcription	Thymus	Thymus
49	chr5:96315600-96321600	Weak transcription	Brain Angular Gyrus	brain
50	chr5:96315600-96321600	Weak transcription	Brain Inferior Temporal Lobe	brain

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links