Variant report

Variant	rs530240023
Chromosome Location	chr2:39643434-39643435
allele	-/AAGATGTTTCTGGCATGTTAATAAAG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

TF binding
region (count:0)
CpG islands
(count:0)
Chromatin interactive
region (count:8)
LncRNA
region (count:0)
Mature miRNA
region (count: 0)
miRNA target
sites (count:0)

No data

(count:8 , 50 per page) page: 1

No.	Distal block	Cell Line	Cell type
1	chr2:39635276..39637954-chr2:39640941..39644825,4	K562	blood:
2	chr2:39643207..39646078-chr2:39648407..39650074,2	K562	blood:
3	chr2:39635451..39641229-chr2:39641645..39645299,6	MCF-7	breast:
4	chr2:39635276..39640508-chr2:39640941..39645614,10	K562	blood:
5	chr2:39642838..39645450-chr2:39657928..39659607,2	K562	blood:
6	chr2:39641793..39644089-chr2:39661719..39663882,2	K562	blood:
7	chr2:39642094..39644271-chr2:39644504..39647283,3	K562	blood:
8	chr2:39638402..39640508-chr2:39641916..39643907,2	K562	blood:

No data

Variant related genes	Relation type
ENSG00000231312	Chromatin interaction

Extended variants
information (count: 4 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:4 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv1827292	chr2:39385155-39675339	Weak transcription Flanking Active TSS Enhancers ZNF genes & repeats Strong transcription Active TSS Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
2	esv1812828	chr2:39396457-39675339	Flanking Active TSS Strong transcription Active TSS Enhancers Weak transcription Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
3	nsv997934	chr2:39473548-39751029	Enhancers Strong transcription ZNF genes & repeats Weak transcription Active TSS Flanking Active TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
4	nsv2695	chr2:39643221-39688015	Enhancers Weak transcription Flanking Active TSS Genic enhancers ZNF genes & repeats Active TSS Strong transcription Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:92 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr2:39622600-39643600	Weak transcription	Brain Germinal Matrix	brain
2	chr2:39633000-39644400	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
3	chr2:39634600-39643800	Weak transcription	Fetal Brain Female	brain
4	chr2:39635000-39644400	Weak transcription	H1 Derived Mesenchymal Stem Cells	ES cell derived
5	chr2:39636600-39651400	Weak transcription	Fetal Thymus	thymus
6	chr2:39637200-39647000	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
7	chr2:39637200-39659000	Weak transcription	Primary T killer memory cells from peripheral blood	blood
8	chr2:39637600-39643800	Weak transcription	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
9	chr2:39637600-39651400	Weak transcription	Primary hematopoietic stem cells short term culture	blood
10	chr2:39638800-39644400	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
11	chr2:39638800-39652400	Weak transcription	Hela-S3	cervix
12	chr2:39639000-39649000	Weak transcription	Primary T cells from cord blood	blood
13	chr2:39639200-39644800	Enhancers	Foreskin Fibroblast Primary Cells skin01	Skin
14	chr2:39639200-39658000	Weak transcription	Fetal Stomach	stomach
15	chr2:39639400-39643800	Weak transcription	Stomach Mucosa	stomach
16	chr2:39639400-39644000	Weak transcription	Fetal Kidney	kidney
17	chr2:39639600-39646800	Weak transcription	Fetal Lung	lung
18	chr2:39639600-39657200	Weak transcription	HMEC	breast
19	chr2:39640200-39643600	Enhancers	Skeletal Muscle Female	skeletal muscle
20	chr2:39640600-39647600	Enhancers	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
21	chr2:39640800-39643600	Weak transcription	ES-UCSF4 Cell Line	embryonic stem cell
22	chr2:39640800-39644800	Weak transcription	Pancreas	Pancrea
23	chr2:39640800-39645000	Weak transcription	Gastric	stomach
24	chr2:39640800-39647000	Weak transcription	ES-WA7 Cell Line	embryonic stem cell
25	chr2:39640800-39647000	Weak transcription	Spleen	Spleen
26	chr2:39640800-39649200	Weak transcription	H9 Cell Line	embryonic stem cell
27	chr2:39640800-39652400	Weak transcription	Foreskin Melanocyte Primary Cells skin01	Skin
28	chr2:39640800-39656800	Weak transcription	NH-A	brain
29	chr2:39640800-39660000	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
30	chr2:39641000-39643600	Weak transcription	Brain Substantia Nigra	brain
31	chr2:39641000-39643600	Weak transcription	GM12878-XiMat	blood
32	chr2:39641000-39643800	Weak transcription	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
33	chr2:39641000-39644800	Weak transcription	Pancreatic Islets	Pancreatic Islet
34	chr2:39641000-39644800	Weak transcription	Small Intestine	intestine
35	chr2:39641000-39645000	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
36	chr2:39641000-39645200	Weak transcription	Sigmoid Colon	Sigmoid Colon
37	chr2:39641000-39645400	Weak transcription	Duodenum Mucosa	Duodenum
38	chr2:39641000-39645600	Weak transcription	Fetal Intestine Small	intestine
39	chr2:39641000-39646600	Weak transcription	Aorta	Aorta
40	chr2:39641000-39651600	Weak transcription	HSMMtube	muscle
41	chr2:39641000-39656600	Weak transcription	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
42	chr2:39641200-39643800	Weak transcription	HUES64 Cell Line	embryonic stem cell
43	chr2:39641200-39646000	Weak transcription	HSMM	muscle
44	chr2:39641200-39650200	Weak transcription	Primary T helper cells PMA-I stimulated	--
45	chr2:39641200-39659600	Weak transcription	Brain Angular Gyrus	brain
46	chr2:39641400-39645600	Weak transcription	iPS-18 Cell Line	embryonic stem cell
47	chr2:39641400-39649200	Weak transcription	Primary T helper cells fromperipheralblood	blood
48	chr2:39641600-39644000	Enhancers	Liver	Liver
49	chr2:39641800-39644800	Weak transcription	Ovary	ovary
50	chr2:39641800-39645000	Weak transcription	Right Atrium	heart

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links