Variant report

Variant rs530502419
Chromosome Location chr1:228334817-228334818
allele -/GCTGCTGGGCCCGGTCCTGC
Outlinks Ensembl   UCSC
Chromatin state (count:121 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:228329000-228336800 Weak transcription ES-I3 Cell Line embryonic stem cell
2 chr1:228329000-228339400 Weak transcription H9 Cell Line embryonic stem cell
3 chr1:228329000-228339600 Transcr. at gene 5' and 3' Foreskin Fibroblast Primary Cells skin02 Skin
4 chr1:228329200-228337400 Weak transcription iPS-20b Cell Line embryonic stem cell
5 chr1:228329400-228336600 Weak transcription hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
6 chr1:228329400-228337600 Weak transcription HUES48 Cell Line embryonic stem cell
7 chr1:228329400-228337600 Weak transcription iPS-18 Cell Line embryonic stem cell
8 chr1:228329400-228338200 Weak transcription iPS-15b Cell Line embryonic stem cell
9 chr1:228329600-228335200 Genic enhancers H1 Derived Mesenchymal Stem Cells ES cell derived
10 chr1:228329600-228335600 Weak transcription H1 Cell Line embryonic stem cell
11 chr1:228329600-228336800 Weak transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
12 chr1:228329800-228336400 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
13 chr1:228329800-228336600 Weak transcription A549 lung
14 chr1:228330000-228335800 Weak transcription Fetal Lung lung
15 chr1:228330000-228337200 Genic enhancers Fetal Muscle Leg muscle
16 chr1:228330000-228337800 Genic enhancers Lung lung
17 chr1:228330200-228336200 Weak transcription Colon Smooth Muscle Colon
18 chr1:228330600-228337200 Genic enhancers Fetal Muscle Trunk muscle
19 chr1:228331000-228335600 Weak transcription HUVEC blood vessel
20 chr1:228331000-228335800 Strong transcription Fetal Stomach stomach
21 chr1:228331000-228338800 Weak transcription HSMMtube muscle
22 chr1:228331200-228336000 Weak transcription Primary hematopoietic stem cells blood
23 chr1:228331400-228341800 Weak transcription Psoas Muscle Psoas
24 chr1:228331600-228337000 Weak transcription iPS DF 6.9 Cell Line embryonic stem cell
25 chr1:228331600-228337000 Weak transcription NH-A brain
26 chr1:228331600-228341000 Genic enhancers Fetal Thymus thymus
27 chr1:228331800-228335800 Weak transcription Brain Substantia Nigra brain
28 chr1:228331800-228336400 Weak transcription NHDF-Ad bronchial
29 chr1:228331800-228336600 Genic enhancers Foreskin Keratinocyte Primary Cells skin02 Skin
30 chr1:228331800-228336800 Strong transcription Primary mononuclear cells fromperipheralblood Blood
31 chr1:228332000-228335800 Weak transcription Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
32 chr1:228332000-228336200 Strong transcription H9 Derived Neuron Cultured Cells ES cell derived
33 chr1:228332000-228336400 Weak transcription Hela-S3 cervix
34 chr1:228332000-228336400 Weak transcription HSMM muscle
35 chr1:228332000-228336600 Weak transcription Fetal Heart heart
36 chr1:228332000-228337000 Genic enhancers Primary T cells fromperipheralblood blood
37 chr1:228332200-228335600 Strong transcription Fetal Adrenal Gland Adrenal Gland
38 chr1:228332200-228335800 Weak transcription Right Atrium heart
39 chr1:228332200-228336000 Weak transcription Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
40 chr1:228332200-228336200 Strong transcription IMR90 fetal lung fibroblasts Cell Line lung
41 chr1:228332200-228337400 Strong transcription Dnd41 blood
42 chr1:228332400-228336400 Strong transcription hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
43 chr1:228332400-228337200 Genic enhancers Esophagus oesophagus
44 chr1:228332400-228339400 Strong transcription Primary hematopoietic stem cells G-CSF-mobilized Male --
45 chr1:228332600-228335800 Weak transcription Stomach Mucosa stomach
46 chr1:228332600-228336200 Strong transcription Muscle Satellite Cultured Cells --
47 chr1:228332600-228336800 Strong transcription H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
48 chr1:228332600-228337600 Weak transcription Small Intestine intestine
49 chr1:228332600-228338200 Strong transcription Primary hematopoietic stem cells G-CSF-mobilized Female --
50 chr1:228332800-228335600 Strong transcription GM12878-XiMat blood

Quick Search:


  
Input of quick search could be:

what's new

Quick links