Variant report

Variant rs530673733
Chromosome Location chr11:67056748-67056749
allele -/GCCCCGCCCGCTCCGCCGCCC
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr11:67055600-67057800 Active TSS Pancreatic Islets Pancreatic Islet
2 chr11:67055800-67057000 Transcr. at gene 5' and 3' Right Atrium heart
3 chr11:67055800-67057200 Active TSS H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
4 chr11:67055800-67057200 Active TSS ES-UCSF4 Cell Line embryonic stem cell
5 chr11:67055800-67057200 Active TSS Sigmoid Colon Sigmoid Colon
6 chr11:67055800-67057400 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
7 chr11:67055800-67057400 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
8 chr11:67055800-67057400 Active TSS Foreskin Melanocyte Primary Cells skin03 Skin
9 chr11:67055800-67057400 Active TSS Brain Substantia Nigra brain
10 chr11:67055800-67057400 Active TSS Colon Smooth Muscle Colon
11 chr11:67055800-67057400 Active TSS Duodenum Smooth Muscle Duodenum
12 chr11:67055800-67057400 Active TSS Small Intestine intestine
13 chr11:67055800-67057400 Active TSS A549 lung
14 chr11:67055800-67057600 Active TSS Fetal Kidney kidney
15 chr11:67055800-67057800 Active TSS HUES64 Cell Line embryonic stem cell
16 chr11:67055800-67057800 Active TSS iPS-15b Cell Line embryonic stem cell
17 chr11:67055800-67058000 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
18 chr11:67055800-67058000 Active TSS iPS-18 Cell Line embryonic stem cell
19 chr11:67056000-67057200 Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
20 chr11:67056000-67057200 Active TSS H9 Derived Neuron Cultured Cells ES cell derived
21 chr11:67056000-67057200 Active TSS Breast Myoepithelial Primary Cells Breast
22 chr11:67056000-67057200 Active TSS Primary neutrophils fromperipheralblood blood
23 chr11:67056000-67057200 Active TSS Primary B cells from peripheral blood blood
24 chr11:67056000-67057200 Active TSS Primary T cells from cord blood blood
25 chr11:67056000-67057200 Active TSS Primary hematopoietic stem cells short term culture blood
26 chr11:67056000-67057200 Active TSS Primary T helper naive cells fromperipheralblood blood
27 chr11:67056000-67057200 Active TSS Primary T regulatory cells fromperipheralblood blood
28 chr11:67056000-67057200 Active TSS Brain Germinal Matrix brain
29 chr11:67056000-67057200 Active TSS Fetal Adrenal Gland Adrenal Gland
30 chr11:67056000-67057200 Weak transcription Fetal Heart heart
31 chr11:67056000-67057200 Active TSS Fetal Intestine Large intestine
32 chr11:67056000-67057200 Active TSS Fetal Muscle Leg muscle
33 chr11:67056000-67057200 Active TSS Gastric stomach
34 chr11:67056000-67057200 Active TSS Lung lung
35 chr11:67056000-67057200 Active TSS Psoas Muscle Psoas
36 chr11:67056000-67057200 Active TSS Rectal Mucosa Donor 31 rectum
37 chr11:67056000-67057200 Active TSS Right Ventricle heart
38 chr11:67056000-67057200 Active TSS Thymus Thymus
39 chr11:67056000-67057200 Active TSS Dnd41 blood
40 chr11:67056000-67057200 Active TSS Hela-S3 cervix
41 chr11:67056000-67057200 Active TSS K562 blood
42 chr11:67056000-67057400 Active TSS H1 Cell Line embryonic stem cell
43 chr11:67056000-67057400 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
44 chr11:67056000-67057400 Active TSS Primary T helper memory cells from peripheral blood 2 blood
45 chr11:67056000-67057400 Active TSS Primary T helper naive cells from peripheral blood blood
46 chr11:67056000-67057400 Active TSS Primary T killer memory cells from peripheral blood blood
47 chr11:67056000-67057400 Active TSS Ganglion Eminence derived primary cultured neurospheres brain
48 chr11:67056000-67057400 Active TSS Foreskin Keratinocyte Primary Cells skin02 Skin
49 chr11:67056000-67057400 Active TSS Brain Angular Gyrus brain
50 chr11:67056000-67057400 Active TSS Brain Anterior Caudate brain

Quick Search:


  
Input of quick search could be:

what's new

Quick links