Variant report

Variant	rs530735736
Chromosome Location	chr17:66381365-66381366
allele	-/ATGGAGGCATGGGTGGCTAG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr17:66377922..66382043-chr17:66382390..66387412,6	MCF-7	breast:
2	chr17:66283450..66289773-chr17:66378313..66385560,13	MCF-7	breast:
3	chr17:66291335..66294055-chr17:66379108..66382514,3	K562	blood:

Variant related genes	Relation type
ENSG00000141337	Chromatin interaction
ENSG00000108932	Chromatin interaction

Extended variants
information (count: 2 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:2 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv833523	chr17:66343323-66510461	Weak transcription Enhancers Active TSS Flanking Active TSS Genic enhancers Strong transcription ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	31 gene(s)	inside rSNPs	diseases
2	nsv960210	chr17:66381299-66386674	Weak transcription Enhancers Bivalent Enhancer	Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:66 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr17:66354200-66390200	Weak transcription	Primary T regulatory cells fromperipheralblood	blood
2	chr17:66369000-66390800	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
3	chr17:66374400-66385800	Enhancers	Foreskin Melanocyte Primary Cells skin03	Skin
4	chr17:66374600-66381400	Enhancers	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
5	chr17:66374800-66381400	Enhancers	Adipose Nuclei	Adipose
6	chr17:66374800-66384800	Enhancers	Foreskin Melanocyte Primary Cells skin01	Skin
7	chr17:66374800-66391000	Weak transcription	Brain Dorsolateral Prefrontal Cortex	brain
8	chr17:66374800-66391000	Weak transcription	Esophagus	oesophagus
9	chr17:66375000-66381800	Enhancers	NHLF	lung
10	chr17:66375200-66382600	Weak transcription	Duodenum Smooth Muscle	Duodenum
11	chr17:66375400-66382000	Weak transcription	Brain Anterior Caudate	brain
12	chr17:66375400-66382800	Enhancers	Foreskin Fibroblast Primary Cells skin01	Skin
13	chr17:66375400-66385400	Weak transcription	Stomach Mucosa	stomach
14	chr17:66378800-66381400	Enhancers	Fetal Thymus	thymus
15	chr17:66378800-66389800	Enhancers	Liver	Liver
16	chr17:66379000-66381400	Enhancers	Primary T cells fromperipheralblood	blood
17	chr17:66379000-66381400	Enhancers	Fetal Adrenal Gland	Adrenal Gland
18	chr17:66379000-66381400	Enhancers	Fetal Lung	lung
19	chr17:66379000-66383600	Enhancers	Fetal Muscle Leg	muscle
20	chr17:66379200-66381400	Enhancers	HSMM	muscle
21	chr17:66379200-66381600	Enhancers	Primary T killer naive cells fromperipheralblood	blood
22	chr17:66379200-66385800	Enhancers	Placenta	Placenta
23	chr17:66379400-66381400	Enhancers	Primary monocytes fromperipheralblood	blood
24	chr17:66379400-66381600	Enhancers	Primary Natural Killer cells fromperipheralblood	blood
25	chr17:66379400-66382600	Enhancers	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
26	chr17:66379800-66381800	Enhancers	Breast Myoepithelial Primary Cells	Breast
27	chr17:66380000-66382000	Weak transcription	Fetal Intestine Small	intestine
28	chr17:66380200-66382200	Weak transcription	Fetal Brain Male	brain
29	chr17:66380400-66381400	Enhancers	HUVEC	blood vessel
30	chr17:66380400-66381800	Weak transcription	Rectal Mucosa Donor 31	rectum
31	chr17:66380400-66382000	Weak transcription	Ovary	ovary
32	chr17:66380400-66382200	Enhancers	Foreskin Fibroblast Primary Cells skin02	Skin
33	chr17:66380400-66382400	Weak transcription	Rectal Smooth Muscle	rectum
34	chr17:66380400-66382800	Weak transcription	HSMMtube	muscle
35	chr17:66380400-66383200	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung
36	chr17:66380400-66390200	Weak transcription	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
37	chr17:66380400-66390400	Weak transcription	Thymus	Thymus
38	chr17:66380400-66391000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
39	chr17:66380600-66381400	Enhancers	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
40	chr17:66380600-66381400	Enhancers	Dnd41	blood
41	chr17:66380600-66381400	Enhancers	Monocytes-CD14+_RO01746	blood
42	chr17:66380600-66381400	Enhancers	NH-A	brain
43	chr17:66380600-66381600	Enhancers	Primary neutrophils fromperipheralblood	blood
44	chr17:66380600-66382400	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
45	chr17:66380600-66383800	Enhancers	Skeletal Muscle Male	skeletal muscle
46	chr17:66380600-66385400	Enhancers	Hela-S3	cervix
47	chr17:66380800-66381400	Enhancers	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
48	chr17:66380800-66387200	Enhancers	HepG2	liver
49	chr17:66380800-66393000	Weak transcription	Primary T cells from cord blood	blood
50	chr17:66381000-66381400	Enhancers	NHDF-Ad	bronchial

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links