Variant report

Variant rs533918823
Chromosome Location chr7:150823175-150823176
allele -/CGTTCCGCCCGCGCCCCCGGCTAACGAG
Outlinks Ensembl   UCSC
Chromatin state (count:122 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr7:150812400-150829600 Weak transcription Small Intestine intestine
2 chr7:150812600-150839800 Weak transcription Pancreatic Islets Pancreatic Islet
3 chr7:150813000-150840400 Weak transcription Primary hematopoietic stem cells blood
4 chr7:150813000-150843800 Weak transcription Primary T killer naive cells fromperipheralblood blood
5 chr7:150814000-150828600 Strong transcription IMR90 fetal lung fibroblasts Cell Line lung
6 chr7:150814000-150842600 Strong transcription Primary hematopoietic stem cells short term culture blood
7 chr7:150814200-150839800 Strong transcription Primary hematopoietic stem cells G-CSF-mobilized Male --
8 chr7:150814600-150825000 Weak transcription Thymus Thymus
9 chr7:150814800-150825200 Weak transcription Primary T regulatory cells fromperipheralblood blood
10 chr7:150814800-150839800 Weak transcription Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
11 chr7:150815600-150833600 Weak transcription Primary T helper naive cells from peripheral blood blood
12 chr7:150815600-150843400 Weak transcription Primary T killer memory cells from peripheral blood blood
13 chr7:150816200-150844000 Weak transcription Primary neutrophils fromperipheralblood blood
14 chr7:150818400-150826600 Weak transcription HSMMtube muscle
15 chr7:150819400-150827600 Weak transcription Primary T cells effector/memory enriched fromperipheralblood blood
16 chr7:150820400-150824200 Genic enhancers Breast Myoepithelial Primary Cells Breast
17 chr7:150820400-150842400 Strong transcription H9 Derived Neuron Cultured Cells ES cell derived
18 chr7:150821400-150825000 Weak transcription Primary T helper naive cells fromperipheralblood blood
19 chr7:150821400-150825600 Weak transcription Primary T helper cells PMA-I stimulated --
20 chr7:150821600-150825400 Weak transcription Primary T cells fromperipheralblood blood
21 chr7:150821600-150833600 Weak transcription Primary T helper memory cells from peripheral blood 2 blood
22 chr7:150822000-150825000 Weak transcription Primary T helper cells fromperipheralblood blood
23 chr7:150822200-150823400 Genic enhancers Lung lung
24 chr7:150822200-150823600 Enhancers Sigmoid Colon Sigmoid Colon
25 chr7:150822400-150823200 Transcr. at gene 5' and 3' Foreskin Keratinocyte Primary Cells skin02 Skin
26 chr7:150822400-150823200 Enhancers Fetal Lung lung
27 chr7:150822400-150823400 Flanking Active TSS Cortex derived primary cultured neurospheres brain
28 chr7:150822400-150823400 Active TSS Duodenum Smooth Muscle Duodenum
29 chr7:150822400-150823400 Flanking Active TSS Fetal Muscle Trunk muscle
30 chr7:150822400-150823400 Flanking Active TSS Rectal Mucosa Donor 31 rectum
31 chr7:150822400-150823600 Flanking Active TSS Foreskin Fibroblast Primary Cells skin01 Skin
32 chr7:150822400-150823600 Genic enhancers Spleen Spleen
33 chr7:150822400-150823800 Enhancers Fetal Brain Male brain
34 chr7:150822400-150824600 Weak transcription Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
35 chr7:150822400-150825600 Weak transcription Brain Angular Gyrus brain
36 chr7:150822400-150825800 Weak transcription Primary Natural Killer cells fromperipheralblood blood
37 chr7:150822400-150827200 Weak transcription Dnd41 blood
38 chr7:150822600-150823200 Transcr. at gene 5' and 3' Fetal Stomach stomach
39 chr7:150822600-150823200 Active TSS Left Ventricle heart
40 chr7:150822600-150823200 Active TSS Pancreas Pancrea
41 chr7:150822600-150823400 Flanking Active TSS Esophagus oesophagus
42 chr7:150822600-150823400 Flanking Active TSS Ovary ovary
43 chr7:150822600-150823400 Flanking Active TSS Psoas Muscle Psoas
44 chr7:150822600-150823400 Active TSS Rectal Smooth Muscle rectum
45 chr7:150822600-150823400 Active TSS Right Atrium heart
46 chr7:150822600-150823400 Flanking Active TSS Skeletal Muscle Male skeletal muscle
47 chr7:150822600-150823400 Flanking Active TSS NHLF lung
48 chr7:150822600-150823600 Flanking Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
49 chr7:150822600-150823600 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
50 chr7:150822600-150823600 Active TSS iPS-20b Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links