Variant report

Variant	rs534300464
Chromosome Location	chr6:4777074-4777075
allele	-/CCCGCCCGCCGCCCCTCCCGG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr6:4775427-4777680	NB4	blood:	n/a	n/a
2	POLR2A	chr6:4775593-4777225	A549	lung:	n/a	n/a
3	POLR2A	chr6:4776461-4777089	ProgFib	skin:	n/a	n/a
4	YY1	chr6:4776254-4777077	K562	blood:	n/a	n/a
5	YY1	chr6:4776412-4777158	HepG2	liver:	n/a	n/a
6	UBTF	chr6:4776457-4777241	K562	blood:	n/a	n/a
7	MAX	chr6:4774967-4777723	HepG2	liver:	n/a	chr6:4775819-4775828 chr6:4776302-4776311 chr6:4777256-4777266 chr6:4777552-4777562
8	POLR2A	chr6:4775007-4777491	MCF-7	breast:	n/a	n/a
9	YY1	chr6:4776702-4777080	K562	blood:	n/a	n/a
10	POLR2A	chr6:4776349-4777668	K562	blood:	n/a	n/a
11	MAZ	chr6:4775403-4777742	GM12878	blood:	n/a	chr6:4775819-4775828 chr6:4776302-4776311 chr6:4777256-4777266
12	POLR2A	chr6:4776412-4777222	ECC-1	luminal epithelium:	n/a	n/a
13	POLR2A	chr6:4775555-4777837	GM15510	blood:	n/a	n/a
14	POLR2A	chr6:4775668-4777730	GM18951	blood:	n/a	n/a
15	EGR1	chr6:4777064-4777573	K562	blood:	n/a	chr6:4777381-4777388 chr6:4777256-4777266 chr6:4777258-4777268 chr6:4777255-4777265 chr6:4777376-4777390
16	POLR2A	chr6:4775605-4777703	GM19193	blood:	n/a	n/a
17	POLR2A	chr6:4777051-4777730	GM12878	blood:	n/a	n/a
18	TBP	chr6:4776461-4777201	K562	blood:	n/a	n/a
19	MAZ	chr6:4776206-4777634	K562	blood:	n/a	chr6:4776302-4776311 chr6:4777256-4777266
20	MAX	chr6:4774991-4777114	HepG2	liver:	n/a	chr6:4775819-4775828 chr6:4776302-4776311
21	POLR2A	chr6:4776384-4777109	GM12892	blood:	n/a	n/a
22	ZBTB7A	chr6:4776715-4777379	K562	blood:	n/a	n/a
23	TAF1	chr6:4776428-4777112	ECC-1	luminal epithelium:	n/a	n/a
24	POLR2A	chr6:4777056-4777226	GM12878	blood:	n/a	n/a
25	POLR2A	chr6:4776452-4777092	HL-60	blood:	n/a	n/a
26	MXI1	chr6:4775628-4778903	SK-N-SH	brain:	n/a	chr6:4776030-4776039
27	POLR2A	chr6:4775177-4778562	GM18505	blood:	n/a	n/a
28	ELF1	chr6:4776368-4777158	GM12878	blood:	n/a	chr6:4776586-4776598
29	POLR2A	chr6:4776444-4777729	K562	blood:	n/a	n/a
30	POLR2A	chr6:4775758-4777189	HUVEC	blood vessel:	n/a	n/a
31	HA-E2F1	chr6:4776388-4777287	Hela-S3	cervix:	n/a	n/a
32	POLR2A	chr6:4776093-4778983	GM12878	blood:	n/a	n/a
33	CREB1	chr6:4777058-4778152	GM12878	blood:	n/a	n/a
34	MXI1	chr6:4776002-4778009	IMR90	lung:	n/a	chr6:4776030-4776039
35	MAZ	chr6:4774846-4778791	IMR90	lung:	n/a	chr6:4775819-4775828 chr6:4776302-4776311 chr6:4777256-4777266
36	POLR2A	chr6:4775633-4777767	GM12892	blood:	n/a	n/a
37	GABPA	chr6:4776373-4777087	K562	blood:	n/a	chr6:4776603-4776617
38	NRF1	chr6:4776399-4777141	SK-N-SH	brain:	n/a	chr6:4776603-4776617 chr6:4776605-4776616
39	POLR2A	chr6:4776346-4778055	Hela-S3	cervix:	n/a	n/a
40	POLR2A	chr6:4776500-4777268	HEK293	kidney:	n/a	n/a
41	POLR2A	chr6:4775838-4778573	GM19099	blood:	n/a	n/a

No.	Distal block	Cell Line	Cell type
1	chr6:4775417..4779410-chr6:4834974..4837006,3	MCF-7	breast:
2	chr6:4776139..4778956-chr6:5002447..5004557,2	K562	blood:
3	chr6:4775727..4780301-chr6:4925378..4930668,5	K562	blood:
4	chr1:155196815..155197641-chr6:4776806..4777313,2	Hela-S3	cervix:
5	chr6:4776830..4778493-chr6:4928400..4930186,2	MCF-7	breast:

Variant related genes	Relation type
ENSG00000236336	TF binding region
ENSG00000124787	Chromatin interaction
ENSG00000153046	Chromatin interaction
ENSG00000160766	Chromatin interaction

Extended variants
information (count: 8 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:8 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv3366530	chr6:4471528-4865322	ZNF genes & repeats Enhancers Flanking Active TSS Active TSS Weak transcription Strong transcription Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
2	esv3429586	chr6:4719363-4792438	Flanking Active TSS Bivalent Enhancer Active TSS Enhancers Weak transcription ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
3	nsv1023527	chr6:4729592-5387176	Strong transcription Weak transcription Enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Genic enhancers ZNF genes & repeats Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
4	esv2422499	chr6:4745428-5073222	Enhancers Weak transcription Flanking Bivalent TSS/Enh Genic enhancers Strong transcription Active TSS Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	18 gene(s)	inside rSNPs	diseases
5	esv3358796	chr6:4775353-4778326	Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Enhancers Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
6	esv3405553	chr6:4775578-4778126	Flanking Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Enhancers Weak transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
7	esv3438069	chr6:4775703-4778001	Active TSS Bivalent/Poised TSS Flanking Active TSS Enhancers Transcr. at gene 5' and 3' Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	5 gene(s)	inside rSNPs	diseases
8	esv3445880	chr6:4775978-4778526	Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region	5 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:123 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr6:4772800-4777200	Active TSS	H1 Cell Line	embryonic stem cell
2	chr6:4772800-4777800	Active TSS	ES-I3 Cell Line	embryonic stem cell
3	chr6:4773000-4777400	Active TSS	HUES48 Cell Line	embryonic stem cell
4	chr6:4773000-4777600	Active TSS	ES-UCSF4 Cell Line	embryonic stem cell
5	chr6:4773200-4777400	Active TSS	H9 Cell Line	embryonic stem cell
6	chr6:4773200-4777400	Active TSS	iPS-18 Cell Line	embryonic stem cell
7	chr6:4773200-4777400	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
8	chr6:4773200-4777600	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
9	chr6:4773200-4778200	Active TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
10	chr6:4774200-4778000	Active TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
11	chr6:4774600-4777400	Active TSS	iPS-15b Cell Line	embryonic stem cell
12	chr6:4774800-4777800	Active TSS	Brain Inferior Temporal Lobe	brain
13	chr6:4774800-4778000	Active TSS	Stomach Smooth Muscle	stomach
14	chr6:4775000-4777600	Active TSS	Brain Substantia Nigra	brain
15	chr6:4775000-4777800	Active TSS	Brain Angular Gyrus	brain
16	chr6:4775000-4777800	Active TSS	Brain Dorsolateral Prefrontal Cortex	brain
17	chr6:4775000-4777800	Active TSS	Colon Smooth Muscle	Colon
18	chr6:4775000-4777800	Active TSS	Esophagus	oesophagus
19	chr6:4775000-4777800	Active TSS	Pancreatic Islets	Pancreatic Islet
20	chr6:4775000-4777800	Active TSS	Gastric	stomach
21	chr6:4775000-4777800	Active TSS	Rectal Mucosa Donor 31	rectum
22	chr6:4775000-4777800	Active TSS	Rectal Smooth Muscle	rectum
23	chr6:4775000-4778000	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
24	chr6:4775000-4778000	Active TSS	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
25	chr6:4775000-4778000	Active TSS	Ovary	ovary
26	chr6:4775000-4778400	Active TSS	Brain Cingulate Gyrus	brain
27	chr6:4775000-4778400	Active TSS	A549	lung
28	chr6:4775200-4777600	Active TSS	HUES6 Cell Line	embryonic stem cell
29	chr6:4775200-4777600	Active TSS	Primary T killer memory cells from peripheral blood	blood
30	chr6:4775200-4777600	Active TSS	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
31	chr6:4775200-4777800	Active TSS	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
32	chr6:4775200-4777800	Active TSS	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
33	chr6:4775200-4778000	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
34	chr6:4775200-4778000	Active TSS	Duodenum Smooth Muscle	Duodenum
35	chr6:4775200-4778000	Active TSS	Psoas Muscle	Psoas
36	chr6:4775200-4778400	Active TSS	Aorta	Aorta
37	chr6:4775400-4777800	Active TSS	Brain Hippocampus Middle	brain
38	chr6:4775400-4777800	Active TSS	Lung	lung
39	chr6:4775400-4777800	Active TSS	Rectal Mucosa Donor 29	rectum
40	chr6:4775400-4778000	Active TSS	Sigmoid Colon	Sigmoid Colon
41	chr6:4775400-4778000	Active TSS	Small Intestine	intestine
42	chr6:4775600-4777400	Active TSS	HUES64 Cell Line	embryonic stem cell
43	chr6:4775600-4777600	Active TSS	Primary T helper naive cells from peripheral blood	blood
44	chr6:4775600-4777600	Active TSS	Primary T helper memory cells from peripheral blood 1	blood
45	chr6:4775600-4777600	Active TSS	Primary T killer naive cells fromperipheralblood	blood
46	chr6:4775600-4777800	Active TSS	Primary hematopoietic stem cells short term culture	blood
47	chr6:4775600-4777800	Active TSS	Muscle Satellite Cultured Cells	--
48	chr6:4775600-4777800	Active TSS	Ganglion Eminence derived primary cultured neurospheres	brain
49	chr6:4775600-4777800	Active TSS	Brain Anterior Caudate	brain
50	chr6:4775600-4777800	Active TSS	Skeletal Muscle Male	skeletal muscle

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links