Variant report

Variant	rs534666784
Chromosome Location	chr4:76185467-76185468
allele	-/ACAGCCATAATCCTCCTAGAGACA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 7 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:7 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1005324	chr4:75689880-76233555	Bivalent/Poised TSS Active TSS Weak transcription Enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer Genic enhancers Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
2	nsv537142	chr4:75689880-76233555	Enhancers Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Active TSS Flanking Active TSS Strong transcription ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
3	nsv1010552	chr4:76064415-76325430	Weak transcription Enhancers Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
4	esv1850883	chr4:76065572-76194403	Weak transcription Enhancers Active TSS Flanking Active TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
5	nsv594686	chr4:76139891-76212995	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Active TSS	Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
6	nsv594687	chr4:76154064-76502748	Weak transcription ZNF genes & repeats Active TSS Flanking Active TSS Enhancers Strong transcription Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	27 gene(s)	inside rSNPs	diseases
7	nsv998511	chr4:76184807-76398377	Enhancers Weak transcription Strong transcription ZNF genes & repeats Bivalent Enhancer Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:8 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:76185000-76185600	Enhancers	Fetal Muscle Leg	muscle
2	chr4:76185000-76185800	Enhancers	HUES6 Cell Line	embryonic stem cell
3	chr4:76185200-76185600	Enhancers	iPS-18 Cell Line	embryonic stem cell
4	chr4:76185200-76186000	Enhancers	ES-I3 Cell Line	embryonic stem cell
5	chr4:76185200-76186000	Enhancers	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
6	chr4:76185400-76185800	Enhancers	iPS-15b Cell Line	embryonic stem cell
7	chr4:76185400-76186200	Enhancers	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
8	chr4:76185400-76186400	Weak transcription	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links