Variant report

Variant	rs535813270
Chromosome Location	chr12:60065611-60065612
allele	-/TATATGTATATATGTGTATATATATGTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 6 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:6 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv869425	chr12:59746898-60479741	Weak transcription Enhancers ZNF genes & repeats Active TSS Strong transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
2	nsv899131	chr12:59942122-60124089	Weak transcription Flanking Active TSS Enhancers Strong transcription Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
3	esv3365928	chr12:60042531-60343212	Enhancers Strong transcription Weak transcription Active TSS Genic enhancers ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
4	esv3423537	chr12:60064510-60067258	Weak transcription Enhancers Strong transcription	Chromatin interactive region	n/a	inside rSNPs	diseases
5	esv3405407	chr12:60064835-60066983	Weak transcription Strong transcription Enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases
6	esv3357152	chr12:60065185-60066633	Weak transcription Enhancers Strong transcription	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:31 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr12:60026600-60089200	Weak transcription	Gastric	stomach
2	chr12:60045600-60071800	Weak transcription	Ovary	ovary
3	chr12:60045800-60085400	Weak transcription	NHDF-Ad	bronchial
4	chr12:60045800-60099800	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
5	chr12:60050000-60068600	Weak transcription	Primary T helper cells fromperipheralblood	blood
6	chr12:60050800-60098600	Weak transcription	Primary T cells fromperipheralblood	blood
7	chr12:60055400-60071000	Weak transcription	Primary T helper cells PMA-I stimulated	--
8	chr12:60058800-60080200	Weak transcription	Fetal Heart	heart
9	chr12:60059400-60071600	Weak transcription	Foreskin Fibroblast Primary Cells skin02	Skin
10	chr12:60059800-60071800	Weak transcription	Psoas Muscle	Psoas
11	chr12:60061600-60071400	Weak transcription	Primary T regulatory cells fromperipheralblood	blood
12	chr12:60061600-60074800	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
13	chr12:60061800-60066200	Weak transcription	Primary B cells from cord blood	blood
14	chr12:60061800-60071600	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
15	chr12:60061800-60071600	Weak transcription	Esophagus	oesophagus
16	chr12:60062200-60069000	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Male	--
17	chr12:60062200-60071000	Weak transcription	Primary hematopoietic stem cells	blood
18	chr12:60062200-60071600	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
19	chr12:60062200-60071600	Weak transcription	Foreskin Fibroblast Primary Cells skin01	Skin
20	chr12:60062200-60071600	Weak transcription	Fetal Stomach	stomach
21	chr12:60062200-60071600	Weak transcription	Pancreas	Pancrea
22	chr12:60062200-60071600	Weak transcription	Right Ventricle	heart
23	chr12:60062200-60071600	Weak transcription	Thymus	Thymus
24	chr12:60062200-60071800	Weak transcription	Aorta	Aorta
25	chr12:60062200-60085800	Weak transcription	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
26	chr12:60062400-60071000	Weak transcription	Dnd41	blood
27	chr12:60063200-60066200	Weak transcription	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
28	chr12:60064000-60068600	Weak transcription	Primary T cells from cord blood	blood
29	chr12:60064400-60071200	Weak transcription	Primary B cells from peripheral blood	blood
30	chr12:60064800-60071600	Weak transcription	Left Ventricle	heart
31	chr12:60065000-60071200	Weak transcription	Adipose Nuclei	Adipose

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links