Variant report

Variant rs535918331
Chromosome Location chr9:100745443-100745444
allele -/CCGCCCCGCCCGCCGCGAGTCTCC
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr9:100740600-100745600 Enhancers Fetal Brain Male brain
2 chr9:100744000-100747800 Active TSS Brain Inferior Temporal Lobe brain
3 chr9:100744200-100747800 Active TSS Fetal Brain Female brain
4 chr9:100744400-100747800 Bivalent/Poised TSS ES-I3 Cell Line embryonic stem cell
5 chr9:100744600-100745600 Active TSS Foreskin Keratinocyte Primary Cells skin03 Skin
6 chr9:100744600-100747400 Active TSS Foreskin Melanocyte Primary Cells skin01 Skin
7 chr9:100744600-100747400 Active TSS Psoas Muscle Psoas
8 chr9:100744600-100747400 Active TSS Osteobl bone
9 chr9:100744600-100747600 Active TSS A549 lung
10 chr9:100744600-100747600 Active TSS HSMMtube muscle
11 chr9:100744600-100747600 Active TSS NHDF-Ad bronchial
12 chr9:100744600-100747800 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
13 chr9:100744600-100747800 Active TSS Duodenum Smooth Muscle Duodenum
14 chr9:100744600-100747800 Active TSS Pancreatic Islets Pancreatic Islet
15 chr9:100744600-100748000 Active TSS Brain Angular Gyrus brain
16 chr9:100744600-100748000 Active TSS NHLF lung
17 chr9:100744600-100748600 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
18 chr9:100744800-100745800 Active TSS Foreskin Keratinocyte Primary Cells skin02 Skin
19 chr9:100744800-100747200 Active TSS Pancreas Pancrea
20 chr9:100744800-100747400 Active TSS Brain Anterior Caudate brain
21 chr9:100744800-100747400 Active TSS Stomach Mucosa stomach
22 chr9:100744800-100747400 Active TSS Stomach Smooth Muscle stomach
23 chr9:100744800-100747400 Active TSS K562 blood
24 chr9:100744800-100747600 Active TSS H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
25 chr9:100744800-100747600 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
26 chr9:100744800-100747600 Active TSS Aorta Aorta
27 chr9:100744800-100747600 Active TSS Fetal Lung lung
28 chr9:100744800-100747600 Active TSS Gastric stomach
29 chr9:100744800-100747600 Active TSS Rectal Mucosa Donor 31 rectum
30 chr9:100744800-100747600 Active TSS Rectal Smooth Muscle rectum
31 chr9:100744800-100747600 Active TSS Sigmoid Colon Sigmoid Colon
32 chr9:100744800-100747600 Active TSS Hela-S3 cervix
33 chr9:100744800-100747600 Active TSS NHEK skin
34 chr9:100744800-100747800 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
35 chr9:100744800-100747800 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
36 chr9:100744800-100747800 Active TSS Brain Substantia Nigra brain
37 chr9:100744800-100747800 Active TSS Fetal Intestine Large intestine
38 chr9:100744800-100747800 Active TSS Small Intestine intestine
39 chr9:100744800-100748000 Bivalent/Poised TSS iPS-20b Cell Line embryonic stem cell
40 chr9:100744800-100748000 Active TSS Esophagus oesophagus
41 chr9:100744800-100748000 Active TSS Fetal Kidney kidney
42 chr9:100744800-100748000 Active TSS Right Atrium heart
43 chr9:100744800-100748200 Active TSS Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
44 chr9:100744800-100748400 Active TSS HSMM muscle
45 chr9:100745000-100745600 Enhancers Fetal Heart heart
46 chr9:100745000-100745800 Active TSS ES-WA7 Cell Line embryonic stem cell
47 chr9:100745000-100746000 Transcr. at gene 5' and 3' Primary T helper 17 cells PMA-I stimulated --
48 chr9:100745000-100746000 Active TSS Brain Germinal Matrix brain
49 chr9:100745000-100747200 Active TSS HepG2 liver
50 chr9:100745000-100747400 Active TSS H9 Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links