Variant report

Variant	rs537456969
Chromosome Location	chr10:1501415-1501416
allele	-/GCACGTGTATGTTCACTGCA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 15 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:15 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv530117	chr10:945438-1729634	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Active TSS Strong transcription Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
2	nsv817532	chr10:964660-1885945	Bivalent/Poised TSS Enhancers Strong transcription Flanking Active TSS Active TSS Weak transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
3	nsv1041498	chr10:1117200-1760190	Genic enhancers Strong transcription Weak transcription Enhancers Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	12 gene(s)	inside rSNPs	diseases
4	nsv1052682	chr10:1162925-1675641	Bivalent/Poised TSS Weak transcription Strong transcription Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Flanking Active TSS Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	9 gene(s)	inside rSNPs	diseases
5	nsv1043944	chr10:1168095-1626019	Enhancers Flanking Active TSS Weak transcription Bivalent Enhancer ZNF genes & repeats Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	9 gene(s)	inside rSNPs	diseases
6	nsv540411	chr10:1168095-1626019	Enhancers Weak transcription Bivalent Enhancer Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	9 gene(s)	inside rSNPs	diseases
7	nsv1045618	chr10:1179519-1537451	Enhancers Bivalent Enhancer Flanking Active TSS Weak transcription Bivalent/Poised TSS Active TSS ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
8	nsv1047911	chr10:1182123-1515126	Enhancers Weak transcription Active TSS Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Strong transcription Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
9	nsv1046041	chr10:1195214-2189155	Enhancers Bivalent Enhancer Bivalent/Poised TSS Weak transcription Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Strong transcription Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	16 gene(s)	inside rSNPs	diseases
10	nsv1037054	chr10:1232041-1865296	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
11	nsv540413	chr10:1232041-1865296	Bivalent/Poised TSS Bivalent Enhancer Enhancers Flanking Active TSS Weak transcription Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
12	nsv549769	chr10:1244020-1764966	Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
13	nsv549786	chr10:1293100-1904598	Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Weak transcription Strong transcription Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
14	nsv549791	chr10:1479049-1511786	Active TSS Flanking Active TSS Weak transcription Enhancers Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
15	esv15663	chr10:1501289-1503104	Enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Active TSS	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:7 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr10:1493800-1504400	Weak transcription	Esophagus	oesophagus
2	chr10:1500400-1503000	Weak transcription	Primary B cells from peripheral blood	blood
3	chr10:1500400-1503200	Weak transcription	Dnd41	blood
4	chr10:1500800-1502000	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
5	chr10:1501000-1503200	Weak transcription	Primary B cells from cord blood	blood
6	chr10:1501400-1501800	Active TSS	Spleen	Spleen
7	chr10:1501400-1502000	Enhancers	Gastric	stomach

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links