Variant report

Variant rs538479195
Chromosome Location chr7:4839729-4839730
allele -/GGCCAGGCTTGCATGAACAGGCGG
Outlinks Ensembl   UCSC
Chromatin state (count:50 , 50 per page) page: 1
No. Chromosome Location Chromatin state Cell line Tissue
1 chr7:4826200-4843400 Weak transcription hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
2 chr7:4832200-4847800 Weak transcription Cortex derived primary cultured neurospheres brain
3 chr7:4832400-4857600 Weak transcription Ganglion Eminence derived primary cultured neurospheres brain
4 chr7:4832400-4859800 Weak transcription Right Atrium heart
5 chr7:4832600-4839800 Weak transcription Gastric stomach
6 chr7:4832800-4840600 Weak transcription Spleen Spleen
7 chr7:4832800-4843400 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
8 chr7:4832800-4847400 Weak transcription Fetal Brain Male brain
9 chr7:4832800-4852600 Weak transcription Brain Germinal Matrix brain
10 chr7:4833000-4840600 Weak transcription H1 Derived Mesenchymal Stem Cells ES cell derived
11 chr7:4833000-4843400 Weak transcription H1 Cell Line embryonic stem cell
12 chr7:4833000-4844800 Weak transcription Lung lung
13 chr7:4834800-4840000 Weak transcription Primary hematopoietic stem cells short term culture blood
14 chr7:4834800-4840600 Weak transcription H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
15 chr7:4834800-4843400 Weak transcription HUES6 Cell Line embryonic stem cell
16 chr7:4834800-4849400 Weak transcription H9 Cell Line embryonic stem cell
17 chr7:4834800-4876800 Weak transcription H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
18 chr7:4835800-4839800 Enhancers Fetal Heart heart
19 chr7:4836200-4877600 Weak transcription hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
20 chr7:4837400-4840400 Weak transcription H9 Derived Neuron Cultured Cells ES cell derived
21 chr7:4837400-4850000 Weak transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
22 chr7:4838200-4840200 Enhancers Skeletal Muscle Male skeletal muscle
23 chr7:4838200-4840600 Weak transcription Brain Anterior Caudate brain
24 chr7:4838200-4840600 Weak transcription Ovary ovary
25 chr7:4838200-4854200 Weak transcription Right Ventricle heart
26 chr7:4838400-4839800 Strong transcription Fetal Stomach stomach
27 chr7:4838400-4841600 Weak transcription Brain Inferior Temporal Lobe brain
28 chr7:4838400-4843000 Weak transcription Skeletal Muscle Female skeletal muscle
29 chr7:4838400-4846800 Weak transcription Brain Substantia Nigra brain
30 chr7:4838400-4859800 Weak transcription Left Ventricle heart
31 chr7:4838600-4839800 Weak transcription Foreskin Fibroblast Primary Cells skin02 Skin
32 chr7:4838800-4840400 Enhancers Fetal Muscle Leg muscle
33 chr7:4838800-4841200 Strong transcription Fetal Brain Female brain
34 chr7:4838800-4849400 Weak transcription Fetal Lung lung
35 chr7:4839200-4839800 Enhancers Foreskin Melanocyte Primary Cells skin03 Skin
36 chr7:4839200-4840200 Enhancers ES-UCSF4 Cell Line embryonic stem cell
37 chr7:4839400-4839800 Enhancers Foreskin Keratinocyte Primary Cells skin03 Skin
38 chr7:4839400-4839800 Enhancers Adipose Nuclei Adipose
39 chr7:4839400-4840000 Enhancers HMEC breast
40 chr7:4839400-4840400 Bivalent Enhancer Fetal Muscle Trunk muscle
41 chr7:4839400-4840600 Enhancers Foreskin Fibroblast Primary Cells skin01 Skin
42 chr7:4839400-4840800 Weak transcription Thymus Thymus
43 chr7:4839600-4839800 Enhancers Pancreas Pancrea
44 chr7:4839600-4839800 Enhancers K562 blood
45 chr7:4839600-4840000 Flanking Active TSS Breast Myoepithelial Primary Cells Breast
46 chr7:4839600-4840000 Bivalent Enhancer Foreskin Keratinocyte Primary Cells skin02 Skin
47 chr7:4839600-4840200 Transcr. at gene 5' and 3' Foreskin Melanocyte Primary Cells skin01 Skin
48 chr7:4839600-4840200 Enhancers Esophagus oesophagus
49 chr7:4839600-4840200 Bivalent Enhancer Placenta Placenta
50 chr7:4839600-4840800 Genic enhancers iPS DF 19.11 Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links