Variant report

Variant	rs541856008
Chromosome Location	chr8:125493062-125493063
allele	-/CAGTCATCTGATTATTGTACAAAA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr8:125492764-125493154	GM12878	blood:	n/a	n/a
2	POLR2A	chr8:125492644-125493086	GM12878	blood:	n/a	n/a

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr8:125491802..125498170-chr8:125548148..125552034,10	MCF-7	breast:

Variant related genes	Relation type
RNF139	TF binding region
ENSG00000147684	Chromatin interaction
ENSG00000147687	Chromatin interaction

Extended variants
information (count: 3 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv531508	chr8:125390194-125587953	Flanking Active TSS Strong transcription Enhancers Weak transcription ZNF genes & repeats Genic enhancers Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	84 gene(s)	inside rSNPs	diseases
2	nsv891433	chr8:125438093-125498547	Enhancers Flanking Active TSS Active TSS Weak transcription Genic enhancers Strong transcription Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	61 gene(s)	inside rSNPs	diseases
3	nsv824727	chr8:125492978-125494998	Weak transcription Enhancers Genic enhancers Active TSS	TF binding region Chromatin interactive region	3 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:113 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr8:125488000-125503400	Weak transcription	Spleen	Spleen
2	chr8:125488200-125498200	Weak transcription	Esophagus	oesophagus
3	chr8:125488200-125515800	Weak transcription	Lung	lung
4	chr8:125488200-125550400	Weak transcription	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
5	chr8:125489000-125496200	Weak transcription	Colonic Mucosa	Colon
6	chr8:125489000-125497200	Enhancers	Primary T helper memory cells from peripheral blood 1	blood
7	chr8:125489000-125498200	Weak transcription	Fetal Muscle Trunk	muscle
8	chr8:125489000-125498200	Weak transcription	Placenta	Placenta
9	chr8:125489000-125501800	Weak transcription	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
10	chr8:125489000-125503400	Weak transcription	H9 Cell Line	embryonic stem cell
11	chr8:125489000-125505800	Weak transcription	Foreskin Melanocyte Primary Cells skin01	Skin
12	chr8:125489000-125519800	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
13	chr8:125489000-125531200	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
14	chr8:125489000-125541200	Weak transcription	Gastric	stomach
15	chr8:125489000-125543400	Weak transcription	Small Intestine	intestine
16	chr8:125489200-125493200	Enhancers	Primary T killer naive cells fromperipheralblood	blood
17	chr8:125489200-125493600	Enhancers	Adipose Nuclei	Adipose
18	chr8:125489200-125494200	Enhancers	Primary T helper 17 cells PMA-I stimulated	--
19	chr8:125489200-125495800	Weak transcription	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
20	chr8:125489200-125496200	Weak transcription	HUES6 Cell Line	embryonic stem cell
21	chr8:125489200-125496200	Weak transcription	Fetal Stomach	stomach
22	chr8:125489200-125496400	Weak transcription	Ganglion Eminence derived primary cultured neurospheres	brain
23	chr8:125489200-125496400	Weak transcription	NH-A	brain
24	chr8:125489200-125497200	Enhancers	Primary T helper memory cells from peripheral blood 2	blood
25	chr8:125489200-125498000	Weak transcription	H1 Cell Line	embryonic stem cell
26	chr8:125489200-125498000	Weak transcription	Fetal Muscle Leg	muscle
27	chr8:125489200-125498200	Weak transcription	ES-I3 Cell Line	embryonic stem cell
28	chr8:125489200-125498200	Weak transcription	Cortex derived primary cultured neurospheres	brain
29	chr8:125489200-125498200	Weak transcription	Aorta	Aorta
30	chr8:125489200-125498200	Weak transcription	Right Ventricle	heart
31	chr8:125489200-125498200	Weak transcription	Sigmoid Colon	Sigmoid Colon
32	chr8:125489200-125498200	Weak transcription	Thymus	Thymus
33	chr8:125489200-125498400	Weak transcription	Fetal Brain Male	brain
34	chr8:125489200-125498600	Weak transcription	A549	lung
35	chr8:125489200-125498600	Weak transcription	HSMMtube	muscle
36	chr8:125489400-125494000	Enhancers	Primary B cells from cord blood	blood
37	chr8:125489400-125497800	Weak transcription	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
38	chr8:125489400-125498000	Weak transcription	Fetal Kidney	kidney
39	chr8:125489400-125498000	Weak transcription	Stomach Smooth Muscle	stomach
40	chr8:125489400-125498200	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
41	chr8:125489400-125498200	Weak transcription	HSMM	muscle
42	chr8:125489400-125498400	Weak transcription	NHEK	skin
43	chr8:125489400-125501800	Weak transcription	Fetal Intestine Small	intestine
44	chr8:125489600-125493200	Enhancers	HepG2	liver
45	chr8:125489600-125494000	Enhancers	Primary T regulatory cells fromperipheralblood	blood
46	chr8:125489600-125494800	Enhancers	Primary T helper cells fromperipheralblood	blood
47	chr8:125489600-125497800	Weak transcription	Primary hematopoietic stem cells	blood
48	chr8:125489600-125498000	Weak transcription	Fetal Intestine Large	intestine
49	chr8:125489600-125498200	Weak transcription	Foreskin Keratinocyte Primary Cells skin03	Skin
50	chr8:125489600-125498200	Weak transcription	Rectal Mucosa Donor 31	rectum

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links