Variant report

Variant	rs542975821
Chromosome Location	chr7:100318442-100318443
allele	-/CACCGCGCCCGCTCTGCTCCGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr7:100317495..100321039-chr7:100423744..100425687,3	MCF-7	breast:
2	chr7:100302553..100308135-chr7:100314195..100322207,16	MCF-7	breast:
3	chr7:100302051..100306591-chr7:100312993..100321692,11	MCF-7	breast:

No.	lncRNA name	Chromosome Location	lncRNA alias
1	lnc-EPO-1	chr7:100318312-100318821	expReg_chr7_6636_+

Variant related genes	Relation type
ENSG00000196411	Chromatin interaction
ENSG00000172336	Chromatin interaction
ENSG00000146828	Chromatin interaction

Extended variants
information (count: 11 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:11 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv1829095	chr7:99814675-100494084	Bivalent Enhancer Active TSS Weak transcription Strong transcription Bivalent/Poised TSS Flanking Active TSS Transcr. at gene 5' and 3' Enhancers Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	393 gene(s)	inside rSNPs	diseases
2	nsv831072	chr7:100162503-100362835	Enhancers Weak transcription Strong transcription Flanking Active TSS Transcr. at gene 5' and 3' Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	82 gene(s)	inside rSNPs	diseases
3	nsv888791	chr7:100221867-100371114	Enhancers Flanking Active TSS Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	50 gene(s)	inside rSNPs	diseases
4	nsv607933	chr7:100240191-100365613	Enhancers Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Genic enhancers Weak transcription Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	42 gene(s)	inside rSNPs	diseases
5	nsv470381	chr7:100240191-100431980	Strong transcription Active TSS Bivalent Enhancer Enhancers Flanking Active TSS Weak transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	49 gene(s)	inside rSNPs	diseases
6	nsv8184	chr7:100240737-100345945	Weak transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Active TSS Strong transcription Enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
7	nsv888792	chr7:100252918-100329189	Enhancers Weak transcription Genic enhancers ZNF genes & repeats Strong transcription Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
8	esv1804951	chr7:100275135-100374093	Weak transcription Flanking Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Enhancers Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
9	nsv1020837	chr7:100313122-100508635	Genic enhancers Weak transcription Active TSS Strong transcription Enhancers Bivalent Enhancer Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	92 gene(s)	inside rSNPs	diseases
10	nsv888796	chr7:100313420-100423365	Genic enhancers Strong transcription Bivalent Enhancer Weak transcription Enhancers Bivalent/Poised TSS ZNF genes & repeats Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
11	esv3410635	chr7:100317416-100319614	Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Enhancers Weak transcription Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:65 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr7:100317200-100319400	Bivalent Enhancer	Fetal Intestine Small	intestine
2	chr7:100317400-100318800	Bivalent/Poised TSS	HUES6 Cell Line	embryonic stem cell
3	chr7:100317600-100319400	Bivalent Enhancer	Placenta Amnion	Placenta Amnion
4	chr7:100317800-100318600	Bivalent/Poised TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
5	chr7:100317800-100318600	Bivalent Enhancer	Primary T cells effector/memory enriched fromperipheralblood	blood
6	chr7:100317800-100318600	Flanking Bivalent TSS/Enh	Primary hematopoietic stem cells G-CSF-mobilized Male	--
7	chr7:100317800-100318600	Bivalent/Poised TSS	Foreskin Keratinocyte Primary Cells skin02	Skin
8	chr7:100317800-100318600	Bivalent Enhancer	Stomach Mucosa	stomach
9	chr7:100317800-100318800	Bivalent/Poised TSS	ES-I3 Cell Line	embryonic stem cell
10	chr7:100317800-100318800	Bivalent/Poised TSS	HUES48 Cell Line	embryonic stem cell
11	chr7:100317800-100318800	Bivalent/Poised TSS	iPS-20b Cell Line	embryonic stem cell
12	chr7:100317800-100318800	Bivalent/Poised TSS	ES-UCSF4 Cell Line	embryonic stem cell
13	chr7:100317800-100318800	Flanking Bivalent TSS/Enh	Foreskin Fibroblast Primary Cells skin02	Skin
14	chr7:100317800-100318800	Flanking Bivalent TSS/Enh	Foreskin Keratinocyte Primary Cells skin03	Skin
15	chr7:100317800-100318800	Bivalent Enhancer	Fetal Heart	heart
16	chr7:100317800-100319000	Bivalent Enhancer	Primary hematopoietic stem cells	blood
17	chr7:100317800-100319000	Bivalent Enhancer	Stomach Smooth Muscle	stomach
18	chr7:100317800-100319200	Bivalent/Poised TSS	HUES64 Cell Line	embryonic stem cell
19	chr7:100317800-100319200	Bivalent/Poised TSS	iPS-18 Cell Line	embryonic stem cell
20	chr7:100317800-100319200	Flanking Bivalent TSS/Enh	iPS DF 19.11 Cell Line	embryonic stem cell
21	chr7:100317800-100319400	Bivalent Enhancer	Fetal Muscle Leg	muscle
22	chr7:100317800-100321000	Bivalent Enhancer	Fetal Muscle Trunk	muscle
23	chr7:100318000-100318600	Bivalent/Poised TSS	ES-WA7 Cell Line	embryonic stem cell
24	chr7:100318000-100318600	Bivalent/Poised TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
25	chr7:100318000-100318600	Flanking Bivalent TSS/Enh	Foreskin Fibroblast Primary Cells skin01	Skin
26	chr7:100318000-100318600	Flanking Bivalent TSS/Enh	Foreskin Melanocyte Primary Cells skin01	Skin
27	chr7:100318000-100318600	Bivalent Enhancer	Esophagus	oesophagus
28	chr7:100318000-100318600	Bivalent Enhancer	Fetal Brain Male	brain
29	chr7:100318000-100318600	Bivalent Enhancer	Rectal Mucosa Donor 29	rectum
30	chr7:100318000-100318600	Bivalent/Poised TSS	A549	lung
31	chr7:100318000-100318600	Active TSS	HepG2	liver
32	chr7:100318000-100318600	Bivalent/Poised TSS	HSMM	muscle
33	chr7:100318000-100318800	Bivalent/Poised TSS	H1 Cell Line	embryonic stem cell
34	chr7:100318000-100318800	Bivalent Enhancer	Primary B cells from peripheral blood	blood
35	chr7:100318000-100318800	Flanking Bivalent TSS/Enh	Foreskin Melanocyte Primary Cells skin03	Skin
36	chr7:100318000-100318800	Enhancers	Ovary	ovary
37	chr7:100318000-100318800	Active TSS	Right Ventricle	heart
38	chr7:100318000-100319000	Bivalent/Poised TSS	H9 Cell Line	embryonic stem cell
39	chr7:100318000-100319000	Bivalent Enhancer	Primary T helper cells PMA-I stimulated	--
40	chr7:100318000-100319000	Bivalent Enhancer	Fetal Stomach	stomach
41	chr7:100318000-100319200	Bivalent/Poised TSS	iPS-15b Cell Line	embryonic stem cell
42	chr7:100318000-100319400	Bivalent Enhancer	H1 Derived Mesenchymal Stem Cells	ES cell derived
43	chr7:100318000-100319600	Enhancers	Pancreas	Pancrea
44	chr7:100318000-100319800	Bivalent Enhancer	Colonic Mucosa	Colon
45	chr7:100318200-100318600	Bivalent/Poised TSS	IMR90 fetal lung fibroblasts Cell Line	lung
46	chr7:100318200-100318600	Bivalent/Poised TSS	Breast Myoepithelial Primary Cells	Breast
47	chr7:100318200-100318600	Bivalent Enhancer	Fetal Adrenal Gland	Adrenal Gland
48	chr7:100318200-100318600	Bivalent Enhancer	Placenta	Placenta
49	chr7:100318200-100318800	Bivalent/Poised TSS	iPS DF 6.9 Cell Line	embryonic stem cell
50	chr7:100318200-100318800	Bivalent Enhancer	Primary hematopoietic stem cells short term culture	blood

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links