Variant report

Variant	rs543074334
Chromosome Location	chr19:22135775-22135776
allele	-/AATGACCTGATGGAGCTGAAAACCATG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 15 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:15 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv3441368	chr19:21781459-22182822	Weak transcription Strong transcription ZNF genes & repeats Flanking Active TSS Enhancers Active TSS Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
2	esv3339694	chr19:21781479-22182792	Enhancers Active TSS ZNF genes & repeats Weak transcription Bivalent/Poised TSS Flanking Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
3	nsv1063115	chr19:21782104-22528039	Weak transcription Enhancers Flanking Active TSS Active TSS Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	38 gene(s)	inside rSNPs	diseases
4	nsv911424	chr19:21798441-22471156	Strong transcription Enhancers Active TSS ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	36 gene(s)	inside rSNPs	diseases
5	nsv911425	chr19:21841379-22338142	Enhancers ZNF genes & repeats Flanking Active TSS Strong transcription Genic enhancers Weak transcription Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	23 gene(s)	inside rSNPs	diseases
6	esv3395280	chr19:21968753-22202288	Active TSS Weak transcription Strong transcription ZNF genes & repeats Flanking Active TSS Enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
7	nsv833785	chr19:22082143-22263312	ZNF genes & repeats Enhancers Active TSS Flanking Active TSS Weak transcription Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
8	nsv1058678	chr19:22084265-22288686	Active TSS ZNF genes & repeats Weak transcription Flanking Active TSS Strong transcription Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
9	nsv1059225	chr19:22084265-22301003	Weak transcription Active TSS Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
10	esv2754060	chr19:22086241-22567144	Weak transcription Flanking Active TSS ZNF genes & repeats Strong transcription Active TSS Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
11	nsv432039	chr19:22086260-22704860	ZNF genes & repeats Strong transcription Bivalent/Poised TSS Active TSS Weak transcription Flanking Active TSS Enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	33 gene(s)	inside rSNPs	diseases
12	esv3384540	chr19:22089182-22316805	Active TSS ZNF genes & repeats Weak transcription Strong transcription Enhancers Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
13	esv3326382	chr19:22112592-22509135	Active TSS ZNF genes & repeats Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Enhancers Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	23 gene(s)	inside rSNPs	diseases
14	esv3392637	chr19:22135121-22332040	ZNF genes & repeats Weak transcription Active TSS Enhancers Transcr. at gene 5' and 3' Strong transcription Flanking Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
15	esv3356148	chr19:22135712-22139910	ZNF genes & repeats	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr19:22134600-22135800	ZNF genes & repeats	Duodenum Smooth Muscle	Duodenum

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links