Variant report

Variant rs546177553
Chromosome Location chr19:42058526-42058527
allele -/AGTCTAAGTTAATCTGTAACTCTAGTC
Outlinks Ensembl   UCSC
Chromatin state (count:41 , 50 per page) page: 1
No. Chromosome Location Chromatin state Cell line Tissue
1 chr19:42055000-42059200 Flanking Active TSS Primary B cells from cord blood blood
2 chr19:42055200-42059200 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Female --
3 chr19:42055600-42058800 Active TSS Colonic Mucosa Colon
4 chr19:42055600-42059000 Weak transcription Spleen Spleen
5 chr19:42055600-42059200 Active TSS Duodenum Mucosa Duodenum
6 chr19:42055600-42059200 Active TSS Sigmoid Colon Sigmoid Colon
7 chr19:42055600-42059400 Active TSS Primary T killer naive cells fromperipheralblood blood
8 chr19:42055600-42059400 Active TSS Rectal Mucosa Donor 29 rectum
9 chr19:42055600-42059600 Active TSS Primary T helper naive cells from peripheral blood blood
10 chr19:42055600-42059600 Active TSS Primary T helper memory cells from peripheral blood 1 blood
11 chr19:42055600-42059800 Active TSS Primary T helper memory cells from peripheral blood 2 blood
12 chr19:42055800-42058600 Active TSS Primary T helper cells PMA-I stimulated --
13 chr19:42055800-42058800 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
14 chr19:42055800-42059200 Active TSS Primary T cells from cord blood blood
15 chr19:42055800-42060000 Active TSS Primary T killer memory cells from peripheral blood blood
16 chr19:42056000-42058800 Active TSS Brain Hippocampus Middle brain
17 chr19:42056200-42058800 Weak transcription Skeletal Muscle Male skeletal muscle
18 chr19:42056200-42060400 Weak transcription hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
19 chr19:42056400-42059400 Enhancers Primary monocytes fromperipheralblood blood
20 chr19:42056400-42059600 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
21 chr19:42056600-42060200 Weak transcription iPS-18 Cell Line embryonic stem cell
22 chr19:42057000-42061000 Weak transcription HUVEC blood vessel
23 chr19:42057200-42058800 Transcr. at gene 5' and 3' Primary B cells from peripheral blood blood
24 chr19:42057600-42058800 Transcr. at gene 5' and 3' Primary hematopoietic stem cells short term culture blood
25 chr19:42057600-42060000 Flanking Active TSS Primary mononuclear cells fromperipheralblood Blood
26 chr19:42057800-42059600 Transcr. at gene 5' and 3' Primary Natural Killer cells fromperipheralblood blood
27 chr19:42057800-42060800 Flanking Active TSS GM12878-XiMat blood
28 chr19:42058000-42059000 Transcr. at gene 5' and 3' Primary T cells fromperipheralblood blood
29 chr19:42058000-42061200 Flanking Active TSS Primary T helper cells fromperipheralblood blood
30 chr19:42058000-42069600 Weak transcription Pancreas Pancrea
31 chr19:42058200-42059600 Active TSS Thymus Thymus
32 chr19:42058200-42060000 Enhancers Primary hematopoietic stem cells blood
33 chr19:42058400-42058600 Enhancers Fetal Thymus thymus
34 chr19:42058400-42058800 Flanking Active TSS Primary T cells effector/memory enriched fromperipheralblood blood
35 chr19:42058400-42058800 Enhancers Adipose Nuclei Adipose
36 chr19:42058400-42059000 Flanking Active TSS Primary T regulatory cells fromperipheralblood blood
37 chr19:42058400-42059000 Enhancers Monocytes-CD14+_RO01746 blood
38 chr19:42058400-42059200 Enhancers ES-UCSF4 Cell Line embryonic stem cell
39 chr19:42058400-42059400 Active TSS Primary T helper naive cells fromperipheralblood blood
40 chr19:42058400-42059400 Flanking Active TSS Primary T helper 17 cells PMA-I stimulated --
41 chr19:42058400-42059600 Weak transcription hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived

Quick Search:


  
Input of quick search could be:

what's new

Quick links