Variant report

Variant	rs546419481
Chromosome Location	chr14:105071108-105071109
allele	-/AGGCCGCGGGAGGCTGCGCCGGGCGGGG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	REST	chr14:105071036-105071864	PANC-1	pancreas:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071744-105071754 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250 chr14:105071737-105071751
2	SP4	chr14:105071089-105071311	H1-hESC	embryonic stem cell:	n/a	n/a
3	SIN3AK20	chr14:105071093-105071407	H1-hESC	embryonic stem cell:	n/a	n/a
4	MAX	chr14:105070984-105071469	A549	lung:	n/a	chr14:105071452-105071462
5	TEAD4	chr14:105071092-105071391	H1-hESC	embryonic stem cell:	n/a	n/a
6	MAX	chr14:105070688-105071455	ECC-1	luminal epithelium:	n/a	n/a
7	E2F6	chr14:105070827-105071416	A549	lung:	n/a	chr14:105071210-105071222 chr14:105071159-105071169 chr14:105071211-105071222
8	HMGN3	chr14:105071059-105071252	K562	blood:	n/a	n/a
9	REST	chr14:105070747-105071761	PANC-1	pancreas:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071744-105071754 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250 chr14:105071737-105071751
10	NFIC	chr14:105070747-105071258	ECC-1	luminal epithelium:	n/a	n/a
11	CHD2	chr14:105070967-105071403	H1-hESC	embryonic stem cell:	n/a	n/a
12	REST	chr14:105070744-105071510	PANC-1	pancreas:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
13	TEAD4	chr14:105071055-105071445	H1-hESC	embryonic stem cell:	n/a	n/a
14	GABPA	chr14:105070679-105071460	H1-hESC	embryonic stem cell:	n/a	chr14:105071194-105071203 chr14:105071192-105071203
15	REST	chr14:105070637-105071754	H1-neurons	neurons:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071744-105071754 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250 chr14:105071737-105071751
16	E2F6	chr14:105070999-105071277	K562	blood:	n/a	chr14:105071210-105071222 chr14:105071159-105071169 chr14:105071211-105071222
17	REST	chr14:105071072-105071469	SK-N-SH	brain:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
18	UBTF	chr14:105071066-105071351	K562	blood:	n/a	n/a
19	ZBTB7A	chr14:105071098-105071323	K562	blood:	n/a	n/a
20	E2F6	chr14:105071006-105071304	K562	blood:	n/a	chr14:105071210-105071222 chr14:105071159-105071169 chr14:105071211-105071222
21	REST	chr14:105070752-105071519	HepG2	liver:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
22	REST	chr14:105070817-105071389	HepG2	liver:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
23	JUND	chr14:105071106-105071365	H1-hESC	embryonic stem cell:	n/a	n/a
24	ZNF143	chr14:105071053-105071426	H1-hESC	embryonic stem cell:	n/a	chr14:105071159-105071169 chr14:105071298-105071316
25	MAZ	chr14:105071071-105071341	K562	blood:	n/a	n/a
26	MAX	chr14:105070814-105071346	K562	blood:	n/a	n/a
27	REST	chr14:105070774-105071774	PFSK-1	brain:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071744-105071754 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250 chr14:105071737-105071751
28	MAX	chr14:105070714-105071485	ECC-1	luminal epithelium:	n/a	chr14:105071452-105071462
29	ZNF143	chr14:105071077-105071380	K562	blood:	n/a	chr14:105071159-105071169 chr14:105071298-105071316
30	E2F6	chr14:105071031-105071401	A549	lung:	n/a	chr14:105071210-105071222 chr14:105071159-105071169 chr14:105071211-105071222
31	REST	chr14:105071046-105071420	SK-N-SH	brain:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
32	MXI1	chr14:105070985-105071477	IMR90	lung:	n/a	n/a
33	GABPA	chr14:105070628-105071491	H1-hESC	embryonic stem cell:	n/a	chr14:105071194-105071203 chr14:105071192-105071203
34	REST	chr14:105070835-105071600	PANC-1	pancreas:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
35	MAX	chr14:105071050-105071363	K562	blood:	n/a	n/a
36	E2F6	chr14:105070663-105071480	H1-hESC	embryonic stem cell:	n/a	chr14:105071210-105071222 chr14:105071159-105071169 chr14:105071211-105071222
37	REST	chr14:105071025-105071678	A549	lung:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
38	REST	chr14:105070782-105071729	U87	brain:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
39	POLR2A	chr14:105070407-105071275	H1-neurons	neurons:	n/a	n/a
40	REST	chr14:105070745-105071461	PANC-1	pancreas:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
41	ELF1	chr14:105071104-105071334	K562	blood:	n/a	chr14:105071159-105071171
42	REST	chr14:105070647-105071745	HL-60	blood:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
43	REST	chr14:105071108-105071359	GM12878	blood:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
44	REST	chr14:105071069-105071370	PFSK-1	brain:	n/a	chr14:105071234-105071247 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250
45	SIN3AK20	chr14:105070950-105071355	PANC-1	pancreas:	n/a	n/a
46	REST	chr14:105070727-105071810	ECC-1	luminal epithelium:	n/a	chr14:105071234-105071247 chr14:105070752-105070762 chr14:105071237-105071250 chr14:105071230-105071250 chr14:105071744-105071754 chr14:105071231-105071249 chr14:105071232-105071242 chr14:105071230-105071244 chr14:105071486-105071494 chr14:105071230-105071250 chr14:105071230-105071250 chr14:105071236-105071245 chr14:105071234-105071247 chr14:105071241-105071250 chr14:105071737-105071751
47	BHLHE40	chr14:105071080-105071347	K562	blood:	n/a	chr14:105071161-105071177
48	MAX	chr14:105070955-105071362	H1-hESC	embryonic stem cell:	n/a	n/a
49	ZBTB7A	chr14:105070921-105071603	ECC-1	luminal epithelium:	n/a	n/a
50	TCF12	chr14:105070970-105071398	ECC-1	luminal epithelium:	n/a	n/a

No.	lncRNA name	Chromosome Location	lncRNA alias
1	lnc-C14orf180-2	chr14:105071099-105072888	NONHSAT040264
2	lnc-C14orf180-2	chr14:105070351-105071697	ucscGeneNc_uc001yrr_2

Variant related genes	Relation type
TMEM179	TF binding region

Extended variants
information (count: 17 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:17 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv530812	chr14:104775571-105364883	Genic enhancers Enhancers Active TSS Flanking Active TSS Bivalent Enhancer Weak transcription Strong transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	98 gene(s)	inside rSNPs	diseases
2	nsv1051647	chr14:104983302-105153720	Enhancers Active TSS Weak transcription Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	30 gene(s)	inside rSNPs	diseases
3	nsv542223	chr14:104983302-105153720	Active TSS Enhancers Weak transcription Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA	30 gene(s)	inside rSNPs	diseases
4	esv1816766	chr14:105007585-105126354	Enhancers Bivalent Enhancer Active TSS Bivalent/Poised TSS Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
5	nsv902372	chr14:105011436-105200377	Genic enhancers Enhancers Active TSS Weak transcription Flanking Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	48 gene(s)	inside rSNPs	diseases
6	nsv902373	chr14:105012858-105078153	Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Weak transcription Active TSS Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
7	nsv470676	chr14:105023512-105100021	Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Weak transcription Flanking Active TSS Active TSS Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
8	nsv456445	chr14:105023512-105170003	Bivalent Enhancer Enhancers Strong transcription Flanking Active TSS Weak transcription Genic enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	39 gene(s)	inside rSNPs	diseases
9	nsv566047	chr14:105023512-105170003	Flanking Bivalent TSS/Enh Flanking Active TSS Transcr. at gene 5' and 3' Strong transcription Enhancers Genic enhancers Bivalent Enhancer Active TSS Weak transcription ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA	39 gene(s)	inside rSNPs	diseases
10	nsv1053591	chr14:105024558-105475931	Active TSS Enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	114 gene(s)	inside rSNPs	diseases
11	nsv542224	chr14:105024558-105475931	Bivalent Enhancer Active TSS Weak transcription Strong transcription Flanking Active TSS Enhancers Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	114 gene(s)	inside rSNPs	diseases
12	nsv1044032	chr14:105036464-105124567	Weak transcription Bivalent Enhancer Enhancers Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
13	nsv902374	chr14:105045524-105119784	Bivalent Enhancer Flanking Active TSS Enhancers Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
14	nsv902375	chr14:105045524-105139894	Bivalent Enhancer Enhancers Active TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Genic enhancers Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
15	nsv902376	chr14:105066444-105100021	Enhancers Bivalent Enhancer Flanking Active TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
16	nsv902377	chr14:105066885-105119784	Enhancers Flanking Active TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
17	esv3338807	chr14:105069932-105072480	Bivalent Enhancer Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:58 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr14:105069000-105071800	Bivalent/Poised TSS	Brain Anterior Caudate	brain
2	chr14:105069000-105071800	Active TSS	Brain Inferior Temporal Lobe	brain
3	chr14:105069400-105071800	Active TSS	Pancreatic Islets	Pancreatic Islet
4	chr14:105070200-105071200	Bivalent Enhancer	Foreskin Melanocyte Primary Cells skin01	Skin
5	chr14:105070200-105071800	Bivalent/Poised TSS	iPS-15b Cell Line	embryonic stem cell
6	chr14:105070400-105071200	Bivalent Enhancer	H1 Derived Mesenchymal Stem Cells	ES cell derived
7	chr14:105070400-105071200	Flanking Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
8	chr14:105070400-105071200	Bivalent Enhancer	Esophagus	oesophagus
9	chr14:105070400-105071200	Bivalent Enhancer	Ovary	ovary
10	chr14:105070400-105071400	Bivalent/Poised TSS	iPS-18 Cell Line	embryonic stem cell
11	chr14:105070400-105071600	Bivalent/Poised TSS	H9 Cell Line	embryonic stem cell
12	chr14:105070400-105071600	Bivalent/Poised TSS	HUES64 Cell Line	embryonic stem cell
13	chr14:105070400-105071600	Bivalent/Poised TSS	iPS-20b Cell Line	embryonic stem cell
14	chr14:105070600-105071200	Bivalent/Poised TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
15	chr14:105070600-105071200	Bivalent/Poised TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
16	chr14:105070600-105071200	Bivalent Enhancer	Primary hematopoietic stem cells	blood
17	chr14:105070600-105071200	Bivalent/Poised TSS	Primary hematopoietic stem cells short term culture	blood
18	chr14:105070600-105071200	Flanking Bivalent TSS/Enh	Fetal Adrenal Gland	Adrenal Gland
19	chr14:105070600-105071200	Enhancers	Left Ventricle	heart
20	chr14:105070600-105071200	Bivalent/Poised TSS	A549	lung
21	chr14:105070600-105071400	Bivalent/Poised TSS	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
22	chr14:105070600-105071600	Bivalent/Poised TSS	HUES48 Cell Line	embryonic stem cell
23	chr14:105070600-105071600	Bivalent/Poised TSS	Brain Substantia Nigra	brain
24	chr14:105070600-105071600	Bivalent Enhancer	Fetal Muscle Leg	muscle
25	chr14:105070600-105071800	Bivalent Enhancer	Placenta	Placenta
26	chr14:105070800-105071200	Flanking Bivalent TSS/Enh	Primary hematopoietic stem cells G-CSF-mobilized Female	--
27	chr14:105070800-105071200	Flanking Bivalent TSS/Enh	Primary hematopoietic stem cells G-CSF-mobilized Male	--
28	chr14:105070800-105071200	Active TSS	Ganglion Eminence derived primary cultured neurospheres	brain
29	chr14:105070800-105071200	Bivalent/Poised TSS	Brain Germinal Matrix	brain
30	chr14:105070800-105071200	Enhancers	Fetal Brain Male	brain
31	chr14:105070800-105071200	Flanking Active TSS	Pancreas	Pancrea
32	chr14:105070800-105071200	Bivalent/Poised TSS	Rectal Smooth Muscle	rectum
33	chr14:105070800-105071200	Flanking Active TSS	Right Ventricle	heart
34	chr14:105070800-105071600	Bivalent/Poised TSS	HUES6 Cell Line	embryonic stem cell
35	chr14:105070800-105071600	Active TSS	Brain Dorsolateral Prefrontal Cortex	brain
36	chr14:105070800-105071600	Active TSS	Fetal Brain Female	brain
37	chr14:105070800-105071600	Enhancers	Gastric	stomach
38	chr14:105070800-105071600	Bivalent/Poised TSS	HSMM	muscle
39	chr14:105070800-105071800	Active TSS	Brain Angular Gyrus	brain
40	chr14:105071000-105071200	Flanking Bivalent TSS/Enh	H1 Cell Line	embryonic stem cell
41	chr14:105071000-105071200	Bivalent/Poised TSS	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
42	chr14:105071000-105071200	Bivalent/Poised TSS	iPS DF 6.9 Cell Line	embryonic stem cell
43	chr14:105071000-105071200	Bivalent Enhancer	ES-UCSF4 Cell Line	embryonic stem cell
44	chr14:105071000-105071200	Bivalent/Poised TSS	Cortex derived primary cultured neurospheres	brain
45	chr14:105071000-105071200	Bivalent/Poised TSS	Foreskin Fibroblast Primary Cells skin01	Skin
46	chr14:105071000-105071200	Bivalent Enhancer	Foreskin Keratinocyte Primary Cells skin03	Skin
47	chr14:105071000-105071200	Bivalent/Poised TSS	Colonic Mucosa	Colon
48	chr14:105071000-105071200	Active TSS	Right Atrium	heart
49	chr14:105071000-105071200	Bivalent/Poised TSS	Stomach Smooth Muscle	stomach
50	chr14:105071000-105071200	Bivalent Enhancer	HMEC	breast

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links